Homo_sapiens Locus Mono:166:AC112218.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:166:AC112218.2
Homo_sapiens
Mono:166:AC112218.2
3
SNORA26L4
1001..1124
2124
TCTGATCTATATTTGTCACTTTTCTTCAATGTTTTTTGTTTCTTCATTTCTTTGAACTT
ATATTTCTTTTTGCCTTCTCTTGTGTCTATTTGCTCTAGAGTTTCTTCTGGTTTGATTGT
CATTTTTTAAATGATTTTTTTTTCTTTTCATTTCTAGTTATTTCTTGAATTCTGTCACCC
TATTTGTAAGATTTTCTAATTCTGATGAATAATGCTCTTTCATGTCTTTTACTGCTTTCT
TAACGTCTTTTAGTTCTTTTCAGATAGTAGGTCACTGTATTTAACTGTTCTTTTTCAATA
TGTCTTTCTGGGTTGCTTTCATTGTCTATACCCCTTTAATTTTTGCATAAAAATACTGAG
ACCCAGTGTTACTCATCCAAGTTCACTTTTCAAAGTATGAAAAACAATGTAATTTTAAAA
ACAAATTTGCATTCTAATGTTTCCTTTGGTGAAAGGTGGCAGAAGCAATTCCCAAAACCA
ACCAGTCAACATTAGACTACGAACTTCCAAAGGTAGGCCACCTTGCTCCAGGGACTGGAA
GTTTCTTTCAGGTAACTGTTTTTCCCTTTTATATCTCAAAAGCAAATGAACTATCAATTC
AGTCAGAAGACACTGCACCAAACAACACTCTCTCAAAAAGTCCTAATGAGTCTTATTTCA
TATCTTCTGTAGTGTCAGTTCAGATTCTGCTTTTGAGATTCTCCCTACAGAAAAGAATCA
TCTCTGACTCCTTTGTGTAAATCAAAGACAGAGATCAATGACATATTGAATTAATATGAA
AGAGCATTTTAAATGCAGACGTCATCCAACACTATCACTGAGCATAAAACTCTGTCTTCA
TTGAAATATTTGATCAATTGTTTGATGTCAAGCAGTATTTTTTAATTAAATATTTGTCCC
TCCTCACATAAAAGGACTGATTACTATCTTTTACAGAAGAATGAATTTAACAGTTTCCTA
CCAATAAAATAGAACTTTGCCCTCAAAATGTTTTAACCATTTGAACTTTAAAATGCAAGT
TCATAGTTCTTTAAGAGACTAACACAGAAAGCTAAAGTAATTCTCCATAAAACCCAGAGA
CGAGATTGTAAAACTCCTCTGTAGATACTGTCTGGAGTCACAGCTTAACCAGAAAAAAAT
TTATCACAATTTAAGCACCTTTCTGATAATTTTATATAGTTCATAGGACAAGTGAGACAT
TTAAGTTTTCTCTGCTTAAAAGGTCATTTAAGCTGAGCATGATGGTGCACACCTGTAGTC
CGAGCTACTTGGGAGGCTAAGGTGGGAGAATCACTTGAGCCTTAGGAGTTAAGGACTTCA
GTGAGCTATGACTGCACCACTGCACTCCAGATTGGGTGACAGAGCAAGACCCTGTCTCTA
AAATAATTAATTAATTAATTAAATCAATGTCTTAGTATACCATGAAGACCACTACCCTGC
CTGAAACCCTTCCATGGCCCGCTTTGTCTTACAGGATGAAAGTCAAGTTGCTTGATGTCC
CATCCCTTGGTGACCTGGCACTTAGCCTCATCTCTGTCAAACATTCATTTAACAAAGACG
ACTTGCCCTCAGCCCAACAAGATGAGATCAGAGGGCTGGAGGTCTCTCACACGTGCCACA
ATCTCTCACACATCCATGCCTTTGTACACTGCTCCCTCCATGGACCTGCCCTTCCACCAC
TCCTTCCAATTGTAAATGCCCGGGCCAAAGGCAATTCATCTGGTGGCCACTGAGGAGGTG
GCTGGGGGTGCGATACTGGCTGGAAAGAAGCACAAAGGAACTTTCCGTATTGATGAAAAT
GATTATGATTTATATCTCCATTGAGGTGGTGTCAATATGGATGTATACATTTGTCAAAAT
TCATTGAGCTATATCACAATCTGTGCATTTTATTTAAATTTTTTAAAATGTTAGGCAACA
AGATAAAAGTCAATTCAAAAGCATCATTTTCGCTGGGTGCAATGACTCACACCTGTAATC
CCAGCAATTTGGGAGGCCAAGGCAGCGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCT
GGTCAACATGGCAAAACCCCATGTCTAGTAAAAATACAAAAATTAGATGGGCATAGTGGC
AGGTGCCTATAATCCCAGCCACTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved