Homo_sapiens Locus Mono:167:AC096917.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:167:AC096917.3
Homo_sapiens
Mono:167:AC096917.3
3
2216
AATAAAGAACTCTTTATAACATTTATTGCATGCTAACTCTGTGGCAAGCACTGGGATGA
AAGCTTTCCATGTATTATCTAATTTAATCCTCACAAACCCTTATTGAAAAGCTTTTGTCA
TTATCCCCATTTTAAAGATGAGGAAACTAAGGTTTATAGGGATTAGAGGGATTATATCAC
CTCACACAGCTGATAAGTAGTGAAGCTGGGCTGTCAAATGCTGTCTGATACCTTAGCTTG
TGCTCTAAACTCAGTTGTACAAAATCATGGAACATGATAGGGAGGACACTGATTTTCCTT
TGATGTCTAAGTAAAATAGTAAAAGGTATACCCCAGCCATTAAACCACTCTGAGTAACTT
TTTTCTATTCTTATTATTTTACCATGAGTCTGTTTTTCATACATGCCCTTGAACTATTAG
AATCCCCCCTCCCAAGATGGCATCCACACAATGGTAAATTACACCTGGCCATTTATTGTA
TGTATGTTCAGGCTTGTTACACATCAGAAAGAGACAGACATGATCCTTGCCTTTATGGAT
CTTACAATGTAAAGGAGAAGAGAGTCAATCAATCACAAGTGTGATGAGTATTATAAAAAA
GGAAGCTGAGTGCTATGGCAAGTATATCACATTGGGAAGGTAACCTGGTTTTGGAGTGGG
GCATGGTTGTGGATAATCTCCATGTGGAGTGAAGTACAATCTCAGAAGCCAAGTATGAGT
AGGCATTAGACCAGTGAAGAGGAAGTCCAGGATGTTACATGGTTTTGAGGCCTGAGAGAG
TACAATAGGGTCCACGCACTGAAGAAGTTGTCAGGTGGGAGCATAGAGAAGGCAGAGTGT
GGTGGGAGATAAAGACAGTGAGGCAGGCAGGGATGGACAATGAAGGCCTTGTGGATTGTG
ACAAGGTTTTAGGATCTTATCATGGAAGCAGTAGTGAGCCACTGAAGATCTCTGGGCAGA
GTGGGAACAGGAAATATTTGGATCTTTAAAAGATCACTTTGAAGATTATATTTCCAGGGG
TCATTTCTGTGGTTCATTACTTAAAGGAGTTTCCCCAAGTGTGTAGAGCACTGGAAACCA
CAGGAAGATATGCAATGTTCTCTCCCGAGCACGAAGCTCGTTCTTGGTGTTGCTTCATTG
CAACTGCCATTTGCCATTGATCATTGTTTTTTTCTTCCTTTGGGGAGATTAAGAGGAAGA
GGACACAGTCTGAGTGATCTTCATTTTAAAAAAAATCTCTTTGGCTGCAGTATGCAAAAG
GAGTTAAACTGAGGAAAACTGGAAGCCTTGGAGTAGGGTTATTGCCATTCTGCTATTCTG
AGATTTGGTGAATCAACCCCCTTTCCCCCCCAGATCTGTGCCTTTTGCAATTTTGAAGAC
GTATGTCAGGGCTCACCCCACCTCTGTCTAGCAAGAAGCAACTTTATCTGCCTCGAATGC
ATTACCATTTTGGTTGATGGCCTCTGAACGTTTTCCATCACAGTCTTCTGCCTCTCCTCC
ATATTCTTTGCTAAATAACATGTTGGGAATGGTCTCCTTGTCTTCCACATCAAATAATTT
AACTGAAACACCATCATAATTACAACTTAATTTCTCTCATTCAAACAGAGGTGATGCATC
TTCTCCCCAAAATAAAAGCCTCCTTAAGCTTACACTCTCACACTCCATAACATGGGTGTT
TACAAGGTTCTTTGCTTTTCTTGCTTGTTGTTACGTCTTTTGAATTGGATTCACCCTCAT
TGTAACTCATTCATCTTGTCAGTCTTAAATTAAGAGTTCCTTAGGGCTGGAGAGAGGGAA
ACATATATCCTTCTAGGCTGTGGAAAGTACACTACAGAACACTAGAACTTTAAGGGAGTC
CCACAGGGATACGACAATGAATGTAGTTTTGTAGTCACTCTTGAATATACTCTTGGCCCA
TAACACATGGAAGATGATGTTAAGATAGTATGTGAGTTCTGAATGCTTTCAGCTGCCTGT
AACAGAAAATTAAAGTGATAGTGCTGAAATCACAGGGATATTTATTACTATGAGAAAACA
GGAGGTAGAGGATCCCAGGGTTAGTTTGGCAACTCAGTAATATCATAAAGGACCCAGTGT
CTTTCATACTCAGGCTCTTTCCTCTTTTGGCTATTGCCTCATGGTCACAAGACGGCTTCT
ACAGCTCTAAGCACAAAGCGTTAACATGACAGCATCTAAAACAGGAAAGAAGAGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved