Homo_sapiens Locus Mono:0:AP005431.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:0:AP005431.3
Homo_sapiens
Mono:0:AP005431.3
18
SNORA70EL1
1001..1134
2134
GGAGACTCTGTCTCAAAATAAATAAATGAATAAAAAAGCAAACAAACCTAAATGGAGTG
ATTTGGGGCTATGTATATGTGAGTGACTTATTAGAAGAGTCCTCATGTTTCTACTAGTTT
TTCTTTGCACTTCTGACCCATTTTGTGTAACTTATTCTTCCTCACCTTTTACAAAGATTT
ATTACAAAACAAACTGCAGTGCCTTGTTGAAAAACCATTCCTTGCAGTGCGATAGGAAAG
TTCTAAAGAACACTGAGTTTGTCTTCTAAGTGTGAACGGAAATTTACAGAGCTTATAGGA
GCACAATAACGTTTTAAAAAATACAGATGTGTGTATGTATTAATTCATTCTCCTTTATCC
TTCATTTATTTTAGTTTTTATTGTGAAATAATAATACACACAAACACCTATGTATCCATC
ACACAGGCCAAGAAACAGCACATTGCCCTGCTCCAGACTTACACCTAACTCGGATTGCAC
TGTCTCTCTCTTTCCTGCAATTTCTGTCATTTCCTTATTTTTCTTTATAGTTGTTATCAC
CTATGCTTTTATCTTGAAACAGTATATCATTTTTGGAATAGAATAAGTAGAGTCATACTT
TGATCTTGTGATGTTTCTTTGCTTAAGATTTTATTTTTGAAATTCATCCATGTTGATGTA
AATCAGTAGGATTTCATTATATGATTACACCACAATCTAAGTATCCATTCCACCTTTAGT
GGCCATTCATGTTGTTTCTTTGCAATTATGAGCAATGCTGTTCTATTTTTGTATGTGTCT
TTGAGGGCACTTGGGCAAGAACTTCTAGAGGGCATGTACCTAACATTGGAATTACTGGTC
CCTGTGTGTGTGCACGTTGAACTTTCTAGATAATATCAAACTGTTTTCTAAAGTTGTTAC
AGTTTGACTCTGGGTACCCATAGTCCCAGCTACTTGGGAGGCGGAGGCAAGAGGATTGCT
AGAGGCCAGGAGTTCAAGTCCTGTCTGGGCAACATAGGGAGATCCCATCTCTTAAATAAA
AAGATTTTTTTTTTAAGAAGTTGTACATGTGCAATGGCTGCAAACAGCAGCTTCCTTGGC
AGTGTGTGCAGCCTGTTTCTTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGGCCTTTC
AGATGGGGGTTCATGTCTCTGACCTTGCACTACCCCAATGTAGGCTCCAAACAGGCATGT
GAGGTGCCTTTGGAAAGAAAGCCCCAGGGCACTGTGGCCAGGGTTAACATTGGCCAAGTT
ATCATGTCCATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGTGCAGG
GCCAAGTTCAAGTTCTCTGGTCACCAGAAGATCCACATCTCAAAGAAGTAGGGCTTCACC
AAGTTGAATGCTGATGAATTTGAAGACATGGTGGCTGAGAAGCGGCTCATCCCAGATGGC
TGTGGGGTCAAGTACATCCCCATTCGTGGCCCTCTGGATAAGTGGTGGGCCCTGCACTCA
TGAGGGCTTCCACTGTGCTGCCCCCTCTTAATACTCACCAATAAATTCTACTTTCTGTCC
AAAAAAAAAGTTGTACGATTTGGATTTGAACCAGTGATGTGCCTGAATGCTGGTTGATCA
CTGCATGACCTTAGCATTAGTAACACCTCCAACACTTGGCATTGAACAACTTTAAAATTG
TTAACCATTCTGGCCAGGCATGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCG
AGGCAGGCGGATCACATGAGGTCAGGAGTTCCAGACCAACCTGGCCAACATGGCAAAACC
CAGTTTCTACTAAAAATACAAAAATTAGCCAGGCCCGTAATCCCAGCTTCTTGGGAGGCT
GAGGCACGAGAATTGCTTGAAACCGGGAGGTGGAGATTGCAGTGAGTCAAGATCACGCCA
CTGCACTCCAGCCTGGGTGACAGAGCAAGACTGTCTGAAAAAAAAAAATTAATTAATTAA
AAAAAATTCAGTCGTTCTGATGGGTGTGTGGTGGTATCTCATTGCAGTTTTTTTTCTAAC
AATTAATTTATTTGAGAGATTCCACAATAACAAAACAGAAACCAAAAACCTTTTTTATTT
CTCCCCAAATCTGGTAAGATTAACTTCTGGCATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved