Homo_sapiens Locus Mono:124:AC027347.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:124:AC027347.5
Homo_sapiens
Mono:124:AC027347.5
5
SNORD3@L6
1001..1213
2213
CTGCACTCCAGCCTAGGCACACAGCGAGACTTCGCTAAAAAAAAAAAAGAAAAAAAAAA
GGGTTCAGGCTGGGCTCAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGTG
GGGCAGATCACCTCAGGTCAGGAGATCAAACAGAGTGAAACCCCATCTCTACTAAAAATA
CAAAAATTAGCCTGGTGTGTAGTGTGTGCCTGTAATCCCAGCTACTCGGGAGGCTGAGAC
AGGAGAATTGCTTGAACCTGGGAGGTGGAGGTTGCAGTGAGCTGAGATTGCACCACTGCA
CTCTAGCCTGGGTGACAGAGTGAGACTCCATCTCAAAAAAAAAAAAAAAAAAGAAGCGTT
CAGGAAAATCTTCTCTAAAAGATAATATTGGAAGAGTTTGGAAAAAGCAGAAGCAGCCTG
CTTTGCAAAGACCTGGAAAGGCATTCCATGTAGAAGCCTAGCAAATATTCCAAAGGGTGT
TCCATTCATGGATTTTTGTCACTTATTTGTTTGTGGAAGGAGTGTCAGTTGAGGGCCTAC
TAAATATCAGGCACTGTGCTGGGTGGTGTAAAATGCGTTGGTCGACAAACCAGCATAATC
CTTATGCTCATGGATCATGATCTGGCAGAATTTTATAAAACTTCTCAAGGCCTGATTCAA
ACACTTAGCCTACACACACTTGGACAGACACAAAAACTGAATGCTAGAATGGCACAAACA
CCTGACCTTTATGAGCAGGAAAATATCTCTTGTTTTTGGGTAAAGAGATGGCAAGAAACC
TCCTTAAAGTTTTGTCACTAGCCAGTCTCGGAGTTTTCCTACTTTCTGCATTGTGTCAAG
AGCTGTTTTATGACCTTCTCTCTGCTCGCTAGCAATTAGAGGAACACAGGTTTTGCACAC
TTAGACTTACTAATATTCATATCTGCAGGTCAATTTGAGTGACAGCATTTCTGGTCAGTA
GAAATACTGACTGTGATTCAAGAAAAGAAATGACTAGATTTAAGACTATACTTTCAGGGA
TCATTTCTATAGCTCATTACTAGAGAAGTTCCCCTGAACGTGTAGAACACTGGCAACCAT
GAGGAGGACATGCAGTGTTCTGTCCTGAGTGTGAAGCTGGGTCTTGGTGTTGCTTTGCTG
CAAGTACCATTTGCCACTGATGATTGTTTTTGTCTCCCTCTGGGACAGTAAGGGAAAGGA
CACAGTCTGAGTGATTATTATTGAAAGCGGGAAAGAAACAGAGAGAAGAAATGAAGAGAA
AGAAACAAAGAAGAAAGAGAGAGAAAGACAGAAAGAAAGAAAGAATAAAGAAAGAGAAGA
AAAGAGAAAAAAAGAAAGGAAAAGAAAAGAAAAACTACCAGATTTTTCAGTGTTAGCGCC
CACAGTTCCTAATATCCCATTCCTACCAGTCTCTGAAATCACTTTCCCTGGATGTCTTCC
TGAGTTTGGCTACTGCACCCACTGACAGTTATACAGCAATGATAAGAGAGGGGTGACACA
AAAGAATGCTGACAGCCTGAAGCCACTGACAGGCTGTCTCTGCTGGCAAGTATAGCATTC
CTGATATACTTAATTAACTAATATCATTAAGTATTACTAATTTATATATTAATATAATTT
TGGCTATCAACAATAAATCTCCTCTGGTTTAATAGGCAGATGATTGATGTTATTTGTCTC
TTTAGAAAGCTCTCTGGAAGAAGCATAAACCCATGAGGTCTAGAGGGAGCAGATAAAATG
GCCAGAGTGGTGAACATGACAACAGAGTTAAGATAATCAGCAGCATTTGAAGAGGTCCCC
AAGCAGAAAAGGATCTAGCAGACCAGGCTGATATTTTCAAAAAGTTGGCTGATACTTAAC
TCATTCTGTTAGACACTTCTCTTTGGAATAGACTGGAGCCTGTTGGGCTGAGGTGGGAGG
AAGGCAAGAAGGGCTGGGCATGGCATCCTAGATGTGGATAAAAGTGGACAATCCCTTCTC
ATAGTCTCCTTTCCTGAGAGAGTTTTAATAATTCTATGATGTTTCCCATCCTCATAAGAA
TATTAGACAGCCTGTTTACCTTGCCTGTAGCCCCTGCTTACTTTGAGCTTCATGTGTCCT
TGAAACCATTGTCAAGGCTGGTTAAACTAAATGTCAGTCACCGCTTTCCACCTGCCCTGC
TGTATGCCGTTCTCTGCCCATGCCTCCTCTTCCACCTGGAGCCCTTAGATTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved