Homo_sapiens Locus Mono:171:AC069499.17
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:171:AC069499.17
Homo_sapiens
Mono:171:AC069499.17
3
SNORA70L3
1001..1134
2134
AGATTCGAATACTAGATTTTTCCCTTGCTGTGTGTTTCTATTCCAAGAATCCTTATTTA
GCACTTATATTACAGATTCCTAGTCACTTTCTTAAGATCCATTTAGATACTAATTAGAAA
TAGTTCTCATATTGCACATGAGAAAGGAATTTAGAAATTCTAGGGTTCGAAATAAAAAAG
AAAATATTGTTAAGTAACAAACTTTGTACTGTTTCAACCTTTCTACCATCTTTTAGATCA
TTGTTGCAAATGATTAGTTCAAAGTCATTCTAATTTTTTTCTTCTGTAAAAACTTGTAAG
GTAAAGGCTGACCTGGAAAAGTCGTACTTCACAACAGACACAAAAGTCACTTGTAGGAAG
ATTACAGATCTATATGTGAAAGTTAAAAAAAACTAGGAAGCTTTTAGAAAAAAACAATGG
AGTCCATCTTTGTGACTTTGTAATAGGCCAAGAGTTCCCAAATGGAACACAATAAACACT
AAATTGATCTATGTTAAAATCAAGGCACCATTAGGTGAGTAAAAAGGCAACTCACAGAAT
GGAAGAAAATATTTGCATGTTATATACCCATCAAAAGACTCCAGAATAACTCCTCCTACT
TATAAGAGAAAGACAACGCATTAAACAAATGAGCAAGAGACATAAACAGACACGTCAAAG
AACATACAAATGGCCAATGAATATGTAAAATGATATTTTTATTAATTAATAAAATATTAA
TTTAAATTATAATGCAATACTACTGTATAGACATTAGAATTGCTAAAATGAAAAAGTGAA
AAATATCAACTGCTGGCAAGAATGCAGACTGACCAAATATTCATAAACTGGTCCAACTGA
CTTTTTTTGAAAACTGTTTCATAGTGACTACTGAACTTACGTATATCCTATGACACAGTG
ATTCCACTCCTAGATATAAAGCTAAAACAAGCTGTCCATAAGCTCACCAAAAGACATGCA
GAAAATGGTAAATGCAGGTTTCTTTATAATAGCTGATGTTCATAAACAAAAGAACACCAA
TTGTGCTCCTTTCCTCCTGGGGCCCAGTGTGCAATGGCTGCAAACAGCTGCCTCCTTGGT
AGTATACATGGCCTGTTGCTTGTATGGGTTGGCCTAAGAAACCTGAGAGACAGCCCTTTC
CAATGTACATTCATGTCTCTGACCTCCTGCTGTCCCCCATCTAGGCTTCTGAGAGCTATT
ATGCAAGGTGTCTTTGGAAAGCCCCCAGGGCACCGTGACCAGGGTTCACAGTGGCCAAGT
CATCATGTCCATCCACACAAATCTGCAAAATAAGGAGCATGCAACTAAGGCCCCATGCAG
CGCCAAGTTCAAGGTCCCTGGCTGCCCAAAGACCCACATCTCAAAGTGGGGCTTTACCAA
ATTTAATGTGGATAAATGTGAAGACATGGCGGCTGAGAAGTGGCTCATCCCAGATGGTTG
TGAGGTCAAAAACATCCACAAATGTGGCCCCCGGACAAGTGGTGAGCACTACATTCGTGA
GGGTGTTCACTGTAATGTCCCCTTATTCATGCTCACCAATAAATCATACTCCCTTGTCCA
AAAAAAGAATCAATCTAACAATCTACAACTATATGAAATATGAGTGAATCTCATCACATT
ATGTTGAACCAAAGAAAGTCTAGATAGAAAACGTATTATATGCTTTTATTTATACAAAGT
TCCAAAATATATATGTACATGTGTATATACACACACACGTGTACGTACACACACGTGTAC
GTACACACACGTGCATGTACACACACGTGTATATATACATATACACACATGTGTATATAT
ACATACACATATACATGTATGCGTGTATATATGTTCACATGTGTATGTATACATATACAT
GTATACATACACATACATATATACATATACATGTATACATGTGAGTATATATACACATAT
ATGCACACATATGTATATATGTATATATACACATACATATATACACGTATATATACTCAT
ATACATGTGTATATATACGTGTATATATACTCATATACATGTGTATATATACGTGTATAT
ATACTCATATACATGTGTATATATACGTGTATATATACTCATATACATGTGTATATATAC
GTGTATATATACTCATATACATGAGTATATATACG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved