Homo_sapiens Locus Mono:179:AC076966.25
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:179:AC076966.25
Homo_sapiens
Mono:179:AC076966.25
3
SNORA25L6
1001..1126
2126
TGAATGACAATGCGAGTCTTTCATTATTAAGCCTGACTGAAGCTTCTAGTTTGGTATAT
CTATTACTTAGTACGTCAAAGAATAGCTTTCTATCCCTATTTTACTAAGGTCGTGTGTGT
GTGTGTGTGTGTGTGCGCGCGCGCGTGTGCACGCGCATGTGCATGTCTGTGCTGGAGAAA
GGAAGAGGGAGGGAGGAAGGGAGGCAGGGAAAGAGAGAGAATTAATGTCTGTTACAGATT
TCCTAAGATTAAAATGACCTTTGTATTTCCAGAATAAATGCCATTTGGCTATGGTATGTG
TGTGTGTTTTAACAAACTACTGAATCTGCTAATATTTTATTTAAGATAACTAATACTTTA
AGTGAGATTGGCTTGCAGTTTTTTTGTATGTGTGTAATGTCTATGTCCACCTCTAAAACA
GAGTAAGAAGTATTATAACAGCTTTTAATATACTGAATGTTTGAAAGAAGAGTAATGAGA
AGGGGCTAGCCTAAGTAGGTATTAAATCCTTAGTTATAAAAATAGAATAGTATTGGCCCA
TGCAGATCCAGAGAACAGAACTGAGTTCAGAAACAAACTTAAGTACAATAGTTGCTGCAA
TTTTGTATAGGGAAAAACCCCAGAACCTTAATTAGGACAGATTATTTAATAGACGGTCCT
GGTAGAATTGATTAGTCACGTGAACTGAAAAAAAATGAATTTTAACTGCTTTAAAATAAA
CGAAGAAAACTTTAAAATGCTCCCAAGTAACACAAAAGATTGAAGACATGGAAAAACATT
CCACATTCTCGGATAGGAAGACAACCAATTCCCAAAATGTCAATTCTTCCTTAGATAATC
TACACATATGATGTAATCCCAATAAAATGCCAATAGGATTTTTGTGTTTGTGTGTAGAAT
TAAGCATGCTGATTCTAATGTTTAAAAAAAAATTGCAGGAGACCAGAAAAATTAGGGGAG
GGGAGAAGGCAGGGGGAGAGAAAGGTCTAGCCCTACTGGATAGGTCACTTCAAAGAGGGC
TTGTGGGGCTGTGAAACCAAGAGGTCTTAACAGTATGACCAAAAACTGAAGTTCTCTATA
GGATGCTGTAGCACTCAATGGTGCTATGTTTTCCTCAGGAGATATGACTCAGCCACTCAT
AAACATAACATGATAGTCCATGATTGTTGACGTGGGAAAATAAATAAACATCTCAAAAGT
TTAACCAAACCTTCTCTTCTCTAGAAAAAAAAATTATGAAACTACAATAATCACAATGGT
AAGATACGGCTCATAAAGAGCCAGACAAAAGGAAAAAAAACCCAGAAATTAAAAAAATAG
ACACAGAATGTGTTACATGATAAAGGTATCATTTCAAATCAATAGGGAAGAGACCACCTG
GAAACGGCTAGACATTTGGGAAAAAAGAGTGGGTTTCCAATTTATACCTTATATTGAAAT
GAATCTTAATAGAATAACAAACACAATATAAAAATAAAATCATAAGGATATAACATTTCA
CCTATATTTGCAAAATTTAAAAAATTGCTAGAACATAGAGCAAAAAGACAGACATAATGA
AACAAGGGTGAAAAAGATATACAATAAATCAAAGAGGTTCAACAACTGAATACTTCCTTA
TTGCACAAGTTCTGAGGTAAGAGAAAAATGGAAGAAAGGAAATTAAAGATATAAAAGAAA
AACATCTGGGAGCTGGAGAGACTTACATGTTTAGATTAAAAGGGACCAGTGGGCAGAATA
AATGTAAAGAACTATACTAGACAATAAAAGATAGAGATAAAAGCTTAAAAGCTTTCAGAG
ATGGAAAAACAAGTAATCTGCAAAAGAAAAATTATCTGACTGGCAATGCTATTCTCATCA
ATAACAAGTAAAAAACAATGCAGTAATTAAAATGCTGGAAAACAATTTGACCAGGAATTC
TATACTCAGCAAACTATCATGTGTAAAGAAAAAATAAAAGTCTTTTCAGACAATTAGTTT
TCCAAAGTTTTACTTCCCCTGAACCAATTCTAAGGCACTTAATTGATTAATTACTCTAGC
CAACCAAAGGTGGAGGTCAAGAAAGAGGAAGAGACCACATGCTAGAAATGGTGGAACTGA
ACCAGTGGTCAAATAACGTAAACAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved