Homo_sapiens Locus Mono:82:AL121944.14
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:82:AL121944.14
Homo_sapiens
Mono:82:AL121944.14
6
SNORD3@L37
1001..1208
2208
CCTCGCTCATATCTGGAAACTGGGAAAAGGATTTTGATTTAACTAGATGGAGTCCAATT
GCTACAGATCCCTACGGGTTATAGACCTTTGGAGAAATGGCTGATCCAGAGGTGGGAAAA
GGGAAGTATAAGTTTGCCCTGAAATATCTTGTACTAAAAAGTAAGGAAGTGTTCAAAGAA
TGACTGGGACATGTGAAAAGGACAAAGAGCCATGGTTATGTAAAATGTTGACATTAGAAA
AGCTGGGTAAAGAGTATATGAGAAGTCTCTGTTCTATATTGCATCTCTTCTGTGAATATA
AAATTTTTCCAAATGAAATGTTTCTTTAAAGTGGACATAAAAGCCAGGTTAAAGGAATTC
CCACTGTACAAATTTGGGAAAGTTGAGCATCAAAATAAATCATGATATTAATATACTATA
ACCCGTATATATTCAGAAAGAAGGAAGGAAGGAAGGAAGGAAGGAAGACTGATTTTTCCT
TGGAGTAGAATGCCAATTAATAACTATAGAAAGAACGATAGGATTAGAAAATCATAATTA
ATTCAGCCAAGAAACATCAATGGGCTGCCACACTAAAACAAGTGTGGCAAGTTTAATGAG
GAATGGGATACTTACATCTCATAGCCCTATAAAATACTTATTAATTACAATGAGAAAGAA
GAATACTTTTCAGTGGAAAAACCTTAACCAAGTGATCAAAGTTCACATCATTTGTAATGG
GCCAAACTGACATGTGTCTTCCCCATACAATGCAAAGAGGACACAGGCTTATTTCTGTGA
CATTTCTGCCAAAGATGTGTAACCTCTATCTAATCATAAGGAAATATTGAATAATTTCAA
ATTGAGAAATTCGGATCATTTTATAAAATAACTACCATGTACCCTTCAAAATATCAAAGT
CATGGAAGTCAAGCAAAGACTGAGGAACTTTTCCACATTGAAGAAAACTAAAACACATGA
GATCTTAGATTGGATCCTTTTGCTAAAAGAAACATTACTGGAAGACTATACTTTCAGGGA
TCATTTCTACATTTCCGGGTAATTTCTTTGAACATGTGGAGCACCGGAAACCACCAGGAG
GAGGCACAGCATTTTCTCTGGAGCGTGAAGCCAGTTCTTGGTGTTGCTGCATAGCAACTG
CCATTTGCCTTTGATGATCATTCTTCTTTTCCTTTAGGAGAATAAGAGGGGGAGAACCCA
GTCTGAGGGATTCCTGTTTAAAACAAACAAACAAACAACAACAACAACAACAAAAATTAT
TGGGACAAGTGTTAAAACTTGAATGGAGGCCGGGCACAGTGGCTTACGCCTATAATCCCA
ACACTTTGGGAGGCAGAGGCGGAAGAATCACTTAAGCCCAGGAGTTCAAGACTAACCTGG
GCAACATAGTGAAACCTCGTCTCAATAAAAAACAAAAATAAGTAAAATTAAACTAAGATT
AATAAAAATTTTTAAAAACCTTGAATGGACTGTGTAATCTAGATGATAGTAATATGTAAA
TGTAAGTTTCATTATTTTAACGGTTGTATGGTTAAGTAGGATAATCTTTTTGTTTGTAGG
AAATACACTAAGGTATTTGGGTGTGATAGAGCAAACTGCTCCTAAATGATTCAGGGAAAA
TAAAATTATCTGTACTACTCTTACAACTCTTCTGTAAGTTTGAAATCATCATAGAATTTA
AAAAACAAAAAACCTTCTGGTACCTAAACCAAAATGAAATCTTTTGGAATGGTTTCAGGA
CTGGCTAAATCTCCTCAGCCTCAAAGATGAGCTAATGGAGATAAGCATCTTACCTGAAAT
GAAACAAGTCTGCCCCCATCCCTGCAGGTGTACTCAAAGTCTAAGGGAAATGCAGATGTT
AGAAGTTTTCTTAGACATGTCCCACTGGTCTTCCTTTCTGGACAGAAAAGCAAATTTGTC
TAATTGCTTCAATGGAGCATATATTCCCGAAAGCTTCAGTGAAGAGAATAAAACATTTTT
AGCTCTCCAATCTGAGATGTTTTGTGAAATGTTAAAGTATAAATTGTCCTTATTACTTCA
GAATAGTTCTTTAGGAGTCTGAGATCAGATTCTCAGACTCCTACTGTGGGGTATGCCGAA
GACTATCAAGAACTTCAGGATGACTTCACAAATGGAAAATGTACCAATTTAACAGGAATC
CTGCCACTGTGTTTCAGCTTAACACAAGTTGAGGGTCACAGTGTCCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved