Homo_sapiens Locus Mono:38:AC009408.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:38:AC009408.4
Homo_sapiens
Mono:38:AC009408.4
2
SNORD118L9
1001..1134
2134
ACCTTATTTGGAAATAGGATCTTTGCAGATAATTCATTAAGATGAGATCATACTGGATC
AGGGTGCGCCCTAAATTCAATGACTGTTCTCCTTATAAGAAAGCCATGTGGAGATGCACA
AACAGACACCAAAGGAAGATGAGCACGTGAATTCAGAGGCAGAGATTGAAGTGAGGCCAA
GGAATGCGAAGGGCTGCCGGCAACCACCAGAAGCTGGGAGACCTGAGGAGCGATTATTCC
TGGATCCTTGAGGGGTGCATGGCCCTGCCAACACCTTGGTTTCAGACTCTCAGCCTCCAG
AACTGACAGACAGTAAATTTCTGTGGTTTTAAGCCTCCTACTTTGTGGTAATTTGTTACG
GTAGTCCATTAGCAAACCAAACAGCAATTTATCCTTCTTGTAGATGAGACACTGCTGGTT
GCCTACCCGGCTGCCATTCACCCATTCTCCTTACATCATAACCCTGAGTTTGTTCAGCAT
CACACAGAAATGTGCTCAGGGAAGGTGGCCCGATACTCGAGGGAAAATGAGTGGCCCAAG
CCAGTCACAGTACATTCATTTCCCTTTGCAAGGAATCGTGGAGGGGATGACACTCGACTC
TGCTCTGGCCTCTGAAATGTGAGGGAAAGTCTGTGGGCAGCCTCCGGGCAGCACTGAAGG
AAAGCCTCCTCTGCCTTCATTCCTGCCTGAGAGATGGTCATGTGAGGATTTACTGTCTGC
AGCCACTGAAGCCCTGGCTCAACCATGACAGAAGGTGACCCAGGGCCGTGATATTGTTGA
GCTGTTAAACCCACAACCTTCAAATGGACTTTTTGTCATGTGAGAAAGATGAACTTATAT
CATTTGGTTGGATGTGCTGTTACTCACAGCTGAAGACAATCTAACAGGCATACTGGTCCT
GATCATTAATACCACTGATAATGGAATCAGGATTAAAAATAATCTAAGACCGGAAGACTT
GCTCCAGATAAAACACACAAACTGGAACAGGAATAAATGCATCATCAGGTGGGATAATTC
TTACCTGTTTCTCCTTTTGGAGGGCAGGAAGAATAGGCTGATTGGAGATGCATGAAATGT
GGTTAATGTCTCTGCGTAATCAGGACTTGCAACACCCCGATTACTCCTTTCTGATTCTCT
GTGAAGAAAAAAAAAAGGAATAAATGTAAAATTTTTGCATTAGGGAGGAAGATGAATTGC
TCTATTAAGATAAAATATAAATGAATATATATTTTAAAATTCTGTATGTCAAAAATACCA
TGGATAAATTTAAAAGAAAAATTACATACTGGGAAAATTACAACACAATAAAATATGAAA
GTTTGTTATCCTTATACAAAGAACTCTTGCAAACCAATAAGAAAGTGGCAAAACAAAAAC
AAAAACAAAAAACCCCCACACACTTCGATAGAAAAATGGTAAGGAATAAGGAAAGGCAAC
TCCCAAAAAAAGAAATTGAATTAATCAATTAGATGAAATTCAACTTCACTGAATACAGTA
GAGAATGCAAATTAAATACAATAAAATACACGGGGACATATTCAGGTTTTGTGAAGCCTG
AAACTTAAAAAAATGTGGGAGCTGGGTCTCCAAAACTGTTATTTCAAAACTAAGTATGAA
TAAGAATTTTATTTGGCCCCGTCTGGGAGGTGAGGAGCGCCTCTGCCCGGCCGCCACCCA
CTCTGGGAAGTGAGGAGCGCCTCTGCCTGGCCGCTGTGCAATCTTCCAAGTGTGAAGTGA
TAGCCTTTCTGCAGGTGTACCCAACAGCTCCAAAGAGACAGCGACCATCGAGAACGGGCC
ATGATGACAATGGCAGTTTTGTTGAAAAGAAAAGGGGGAAATGTGGGGAAAAGAAAGAGA
GATCAGATTGCTACTGTGTCTGTGTAGAAAGAAGTAGACATAGGAGACTCCATTTTGTTC
TGTACTAAGAAAAATTCTTCTGCCTTGGGATGCTGTTAATCTATAACCTTACCCCCAACC
CCGCGCTCTCTGAAACATGTGCTGTGTCAACTCAGGGTTAAATGGATTAAGGATGGTGCA
AGATGTGCTTTGTTAAACAGATGCTTGAAGGCAGCATGCTCGTTAAGAGTCATCACCACT
CCCTAATCTCAAGTACCCAGGGACACAAACACTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved