Homo_sapiens Locus Mono:88:AL365205.35
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:88:AL365205.35
Homo_sapiens
Mono:88:AL365205.35
6
SNORA8@
1001..1140
2140
TCCAAACAACCAGATGGACTGGTCTACTCACTATTTCTTCAGACGTCCCAAGAACAGTC
AATTCCTTGAGATGCTATCCTTCCTCTTCTGTACTAACCCTCAAAAGCCAGCTTAGGTCC
TGTCCTTTTTTAAAGGCTTTTCCTGACCATTCTACTACCCAGTGAATCTCTCCCTCAAAG
AACACCTCATTGTTCACAGTCCTCAATTGTTTTATCTGGTTTACTAACCATAGTCCAAAC
TCCTTAAGGCAAAGTCTGTACTGTTTTTTTTTTACCATTCACCCCCTGCACAAGGCTCTT
GATATAAAGAACTAAGAACTTGACCCCAAATCTTTCCTGGGCATCTTTTACTCATGTTAC
CTGATAGTCTTGATTTGTAATTCTAGGTGGAGCTGCTTCCCTTTGATAAATTAACTGAAC
AGAGACAATTATCTTCTGAAATTCTGTGATGATAGCTCATTTAACCTATTCTCTCCCAGT
TCTAGCTCCTTTACAGGGCACTATGTAAGACTATCATGCTTTCCTAGCTACATATGTATG
TACTGGCAAATGCCTAAGTCCTAGTATAAACAAAATTGGGTATGTGCAGGCAAAAAAGTC
AAATGTTTAAAAAGACTTGGCTTTCAATAAACAGCTCACACACATGGTGTGTTGCTTGCA
AAGAGAAAAAACAAGCACGGTAAGGATGCCATTTTTAATGGCTCCCAAAAATATGACATA
CTTAAACGTGTTTTTTTCCAACTAGAAACCTGGTGTTATTATGAGGACTGGGTTGTTCAA
GGATACCAGCGTCCATGAAAGGGTATTTTTGGCAAGCACTTTATCACTAGAAATTAGTCA
AAAAAAAATTTTCTGAGCACTCGCCTACAATATACCAAACACTATGCTTTAGGTGTAGAA
ATCAGCCAAAACAAGATTAGGCAACATTACAAAAATATCAACTAACTAAAATGATTGACT
AATTGGATGTCTTAAATCTTAAAACACTAGAATAATTTAATTGCATTGCCATGGTATCTG
CACTCAGTAGTTTATTCCTGCTGGGTGTCCAAAGATCAGTGCCATAGAAATTCAGTATCT
AGCATCACTGATTTTCTTGGCTTTGTGCTTGTTAAAACTTGGTATTTCTATTGACACAGT
ATTTCTTTTTTTCTTTCTTTCTTTTTTCTTTTTTTTTTTTTTGAGACAGAGTCTCGCATT
GTTGCCCAGGCTGGAGTGCAGTGGCGCGTCCCCGGCTCACTGCAACCTCCACCTCCCAGG
TTTACACCATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGTGCCCGCCACCA
TGCCCGGCGAATTTTTTGTATTTTTAGTAGAGATGGGGTTTCACCGTGTTAGCCAGGATG
GTCTCGATCTCCTGACCTCATGATCCGCCCGCCTCGGCCTCCCAAAATGCTGGGATTACA
GGTGTGAGCCACCACGCCCGGCCTTGACACAGTATTTCTGTAGTTCTATAGTTTCCTCAT
ACTGTTCAGATTCATATAGTCTTCAATAGCAGCTAGAAAAAACTCACTAAGAATAAATAT
AATCAAATATTTCTTTTATTCTTTTGCTTCTCAGTAAATGTTTTCTCATTAATTCTCAGT
AGAAATAATTTCAGAATTATAATAATAAAGTATTTAAGCACTGACAGGAAACGCTACTCC
AATAACTTCTTCCATACTCGAACAATTTTTGAAAGATTTTAGAAAAGTGATTCTAATTTG
AAATTCAAATAGTGCAAATAAATCCATGTAAAATAACTATACCAAACCTTCTCTCTCAGT
AGTTCTTATTGGTATGGGTAAAAATATAGGTTAAAATAAGGCAAAGGTGGACAAGATTAT
CACAGCATGTGTGTAAGATTTCTGAAATGTAAGAAGTAGTAGCAAGATTTCTGGACCCTA
GAAAGGGCCAAATGATGAGGTTTGGGGTGATAGTACATTTGGAAAACCCTATTTATTAAC
CTAGTCCACACTATTCAGCATGTGATTTCAAATCTGTCTTGGCAGTTTATCTACGAAGCT
GTTGCTGAATTCTGCCCTTTTGGCAAAACACTTCCAATGTTGGTAAAGTGAGCACAAAAC
TAGAAAACATGTTGAGTATATTAAGTGGGTCCACTTTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved