Homo_sapiens Locus Mono:50:AC007966.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:50:AC007966.3
Homo_sapiens
Mono:50:AC007966.3
2
SNORD118L11
1001..1133
2133
AGCTTTTAAAATCTTGCCCAATATTACAGAACTTGGAAGCGTTAGAACTTACAGCTCAA
CTCAGACAGTCTTCATTGTTTCTGCTCCTAATCACTTGACTGATAGGTATTTTTCAATTT
GTGTCATTATTTAAGTTAATGTATTTTACTGATTCCTGAGTGGAATAAAATTTAAATGAG
TACATGATTTTTCTAAACTTGTACTAATTTTATATTAAAATATACGTTCATTTGTTATAA
ATTCATGCAGTTCTGGATTCTGTGAATTACTAATTGTTTCTGGACAAAATTAACAGAGAG
AAAATTGTTCTTATATTTTCTAAGGAACAGTTTTATCAGCAGTTTTTTATTTATTTATTT
TTATTTATTTATTTTTTCCTGATTGCTTAAGTGTCATTTTGAGGAATAAACTAGATAATG
ACTTTAAGGAAAAAGTGAAACATTGAATTTCCTCTTAAATATTAACAAGTTTAATATGTA
AATAAAATAGCATAAAATATTATATTCCAGAGGTAATTAAAAACGACAATACCATTAAAA
GTGCCGTCTTCAAGTGAGATTTTTATATTTTTATTTTTTGTTGCATTTTATGTTTTATCT
TTCCAATAGTGAATGAATAGTAAAATACCGTGACTAGTGATAGTAGTGTTCTGTTTATGT
TATGTGGATTTCGACATCAAATATCTAGAGAGTGACAAAAAGTGGTGATTTTTAAGAGTA
TACTACAAAAACCAAATTTGCTAAAGGTTAAATGGTGCTAACAAAGAAATATTAACTGCA
AAGAAAATGACATTTTTAAACCTGTCCTAGAATGCACTTTATATTAATATTTGTAAATTT
ATACATTATACATTGGTTCCTAAAAGGAGATCAGGGGCTATTTTATTTACATAAAATAAA
GCAAACTATTACTATTGATATTACTATTTCTAAGTCCTACTTTGATATAGAAAGTGATCA
TATAAAGTCTGGAAATTATACTTCTTAAATATCACCAGATATTATCAGCTGGGATAATCT
TTACCTGTTCCTTCTTTTGGAGGGCAAATTAGGACATGATTGGGGTTCACATAGTATGCG
ATTAACGTCTCTGAGTAATCAGGACTTCCAGTACCCTGATTGTGCCTATCTGATTCTTCC
TGAAAAAAAATTACCAGGAATGATAAAGAGGTGATCACGTATATGGTTAATTATTTTTAA
ATGTCCATTTATTTATTTAATCTAATGGAGAAGTCAATATTAAAATTCTTGAAATTGTCC
AGTTGGCAATAAGTAATATAAAATGCTTTTCTGTCTTAAACTACAGTTTCCAAATACTTC
TGTGATGTGAATTCCACTACCTCTAAGCAGAGAAATTTGAGAAAAATACTTTGCAATATA
AAAAATATTAACATTATTCACTAATATTTTCAACTTATAAATTTGAACTACATCTGCAAT
TATACTGAGTATTTTTATAGTGAATATAATTTCTATATATATGTTTGATCATTTTTGCTC
TTATGAAAACACAATATACGTTTAGTTTGTATTGTAGAGACATGGAATTTAGTGAAAAAT
ATGCTTCCTTCTATTCCTAACTAGATATTACCACTTGTGGTTTCAATAGGAACCTCACAC
TTACTGAAGCCATTTTCCAGAGAAGCCAAACCAATAGGATAAATATAGTTATACAATAAG
TCCTCACTTAACTTTGTTGATAGGTTCTTTAAGCAAAACAATGTACAGCAGGTCTTCAAA
TAAGGTTGTTTCCTGTTTCTTTCAATGTTGGTTGTTTCATTATAATGTTGATGAGAAGAA
AAACATTGGCTTTGTTATACATATTTTTGCTTAAGCTCATATTTTCCAAGAATTTACTAA
TGATATTAAATGAGAATTTACTGTAGATAAGAGAAGATATATTATGATAATTGAGTCATG
CAATTATGGGGGCTGAGAAGTCCCACAACGTGCTGTCTGCAAGCTGGAGGCTCAGAAAAC
TTGATAGTATAATTCAGTCTGAGTCCAAAAGCCTGAGAACCAGGGAAGCTAATGATGCCT
CTCCCAGTTTAAGGCCAAAGGCCTGAGAACCAGAAAGTGGGAGCAGGCACTGGTGTCCCC
AAGTCTGAAGGCTGAAGGACCAGGTGCTCTGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved