Homo_sapiens Locus Mono:55:AC073149.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:55:AC073149.5
Homo_sapiens
Mono:55:AC073149.5
2
SNORA48L8
1001..1134
2134
TGTCATTTTTCTCTTTTCCCTTTTCTTCTTCATGGACAACCATTTAAGGAATGCGGGGG
GAGAGGGCTGGGATGACGATGTGACCAGGTTAAAAGCAGCCCAGGACATAAAATAAAAAA
TTAAGGGGGGGGGGACAGTTGTAAACTTCTGAAAATAGAAACTGCCTCAAATGTGTTATT
CCAGTACACCAGACCCTCCTTCTGAGTTCAAGATTCCCTTTGTGCCTCGCCACAGGATGT
GTTAAGATGATATACAGTGTGTTTAAATAAAACAAGAAAACAAACCAAGAAAAATTTAGC
ATTATGAAGAATGAGAGTCTACTAAAAATACTCTAAAATGACTTCAAACATGAAATCACA
TTTAAAAAATAACTTTTTAATGACTTAGGCATAAGTGACTCAGGAACATATGGATTACAT
TTCCTTCAAAATGCATATGGCTTTAACAATTGGGGGAGATTTGTTTGGTTTGTAGGACAC
AGTTCTGAAAAGGAAAGAAGTCTGTCAAACGGGACTCACGTTTTCTGGTGCTTTCTTTGG
TGACGGAGTCAATTGGCCTTAATGGCCATTACCTAAGAAACTTGGAACAGCTTCCTTGGA
TGTAGTTTAACTCCCTTTCCCTATTTAGGCAAAGTATTCAACACATTTATAATAAATGAC
TCTCCTTCACCCCTAATATCTCAAGCATCAAAAACAGGTCTACTTCCTTAAAAAAAAAAA
AAAAAAAAAGGCTGAGCTGTCTTAGCCCAGAGCAAATGGCTATTGCTGCTTTGTGACAGT
TGGGCACAGACTTATATACAGGGATGTTTTTCATTCTTTTAGCCCATTAGGAACTAAGGT
CAAGAGAATGTCACTTTTTTTTTCTTAAAAACACAAATTTTAGACAAAGTCTGCAACAAT
CAGGCTCTCTGTTACCGGCCGAGCCTTCGGTTTTTATCACACCAACCTCACACTCTCACC
AATGCTACTGCCACCACCACCATGACTATAAAACACCTCAGTGTTCTGACATGGGAAGAG
TAGCTTCTGGTTGGTGGAGCCCATCTCACATTAGCCAGAGACAAAGCAACACCTTGTTTA
TCCCGGCTTGGCTTTTGGCCTGTGTCCATGACTGGTCCATACCTTGGACACATGGATGGT
TAAAGAAAGAAAAAAAATCCCTTAGCATTCACAATGTTTAACTGTTTCCAAAAGGCACCC
TCAAATATCATCTTCTTCCATCCTGGAGGACAGTTATGACAAGTACTGAACCCACTCCTC
AGATGAGGAAATTGAGAGCTGAGGTTCAGGGAAAAGCCACATAGCAACAACTAGCCATTC
TGCAAACACCGATTATACTTTCATGCCTTGGCTTCTTTTATTGTTTCCTTTGGCTAATTT
TTAATAGTCACCCCCTCTAGAATGCCAACTGCCCCACTTAAAAATTCCCCATTTTCAAGG
GTCAGAACAAATGGCACATGTTTCGGAGAGAGTGCGCAAACATTCAATCTCCAAGTGCGA
TGCTCTTTTTTGTGTGTCAAGTGGGCTAAGCCACCATCTCAGGTTATTCAATTAAACACT
AATCAGGGTGCTGCTGTGAAGGCATCTGGTAGATGTGATTAAAGTCCATAATCAGCTGAC
TTTAAGGGAGATTATTTTAGATAATGTGGATGAGCCTGATTCAATCGGTTAAAAGGCCTT
AAGAGCAGAGCTGAAACTTCCCTGAAGAAGAAGAAATTCTGCTTGTGGACTACAGCTTCA
GCCAAGTGCCTGAGAGTTCCTGCTCACCCTTCCTGACGGCCTGCCCTACAGATTTTGGAC
TTGCCTGGTCAGCCTCCACAATCACATAGGCACTTCCTTGCAATAATAGCTCTTAATATA
TGTCTCCACTGGTTTTGTCTCCTGGTTGAACCTTAACTGATAAACCAGGTAATATCCCCT
CTGGGTTCTTCCAGTTTATACAACTCTTATATCATTTCCAGCTTATTGGTGGTACTGTAA
CTTCTTTGTAGGTAGGCTCATGTCTCCTATCTTTGTAAACTACACAGCACTAAATATTTG
CTGCAAGAATTAAATTATGTTATGCAAGAGCAGGACAGAGGGTGTTTCACCCTCCTATGA
GATAAGTAAAACTCATACAAAATGCTCATGAAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved