Homo_sapiens Locus Mono:33:AC015982.9
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:33:AC015982.9
Homo_sapiens
Mono:33:AC015982.9
2
SNORA12L2
1001..1148
2148
TTCGTAAGTTACAACATGGAGTAGTAATTCAACATATAAATGATATGGGGTAGGGGGGA
CGCCTTACCCTCCTATTCAACTCTATGCTATCCAGTGATGGAAAGAAAATTCCTCAGTAA
ATTTCACATGGAAAATCTGAACTACAAACAATTTTGGACACAGTTTTGTAGGCTATAAAA
GCAGTATACTTAAACAATACCTGTTCAGTTTCTGATTTTGTCTGTCTTTTTCTTGCTCAT
ATTTAGTCTTCAATCCTTTGAATGTCTGAACATATTCAATCGATTCAAGTGCTTTATAAA
AGTTTTCAACTATATGGGCAGTAAGAGACTTGATATCTTCCTGTATAAGCACAAAATTTA
CATTTAAAATATAATACAATGCTTGTTAGAAGAAAAACTTTAAAATTTTGTTTTGTAGTT
CTAAAGCTGATCAAAAAAGGTTTTTCAAAATCACCTTCCAAAATGTAATGTCCTGGTTTC
TTTACACATGAGTCAGGACTGCACAGAAAACTTGAAAAAAAAGGAGAAGCAATTTACTGG
AGTCCTTTTATAGGACTATAAAGAGCATTCGAAAAGTAAATAGATTTATTTTACATCTTC
TATTTTTTGTATATATATATATATATATAGCAGTTTACAATTTAAAAAGCACTTTTACAT
AAAATTTCATTTGATCTTCACAACAATTCTATGAGATAGGTTTTATTATTCCCATTTTAG
AGAAAAACCAAAATTGAGGCTCTAAGAGAGGCTGGATGGTTTGATCCAGAGCACACGGCT
GGTTAGAGGGCAGATGTTAAAATTACATTTTCAAAATACTCACGGTGATGGATACCCCAA
ATACCCGGACTTGATCATTACACATTCTATGCATGTAAAAAATAAATACATGTACCAAAT
ACATCTGTATAATATTATGTATTAATAAAAGAAAAACATATTTTTCAACAAACAGGTCTT
ATTTAATGACTTCCTGTTTAACTGCTATCAAAATGGGATATGGTTGTGGTGGTTTTCTTT
CTGGTACATTTGTTAAGTTTTCAAATGAGCCTAACTCTGCCACATATATCATATAGGAGC
TGGCAAAGGCTTGATGACAAAGAGATCTCTCTCAAGCCTTTCCCACATCAGAGGCTGGCT
TTCACACACACAGAAGAAGAAAAAACAACAGAGGACACGTGTTACCTAAATAATAAGAAG
CAAAGACTTCTCTGACTATATTATACACACAGATCTGATAAACTATCTGGAATTCTACTT
GTCTATTCCTATAGTCTTCCAATAGTATAATATCTGTGAAATAAACTAATTGATAGTAAT
AACTTCTAAATTCTAAACCATCACTGCAAATGCATGCATGCCCAGTAGGCTTATTTTAAA
AAAAAAAATTAAAGTTGTGATTGAGGACTTTACAGATAACACTACATAGTAAGAAACACA
CAGGTCATTTCTTGAAAAGATACACCATAATTTGGTTGCATTATGGATTTTAAGTCTTAA
AACTAGTTCTCCTGTACTTCTCAATTGAAAAAAAATACGCAAATCAGAAATTAGAAACCT
AGGTAATGGCTCTATGTTATATGTGAAACGAAAAAATACATTAAGTTTTGGGGCACAAGG
TACACAAATCGACCACTCGAACTTATTTTCACAAAAACAATTCCATCATGGGCATAGGGA
CAGGGTTGTAAACTCTACCATTTGCTTTATCTGTATCTCACCAAAATTTTAAAGGAGAAT
AATATAAAGTAAATAAAATATAAAGCTTTGATTTATTGCAGCAGTACAATGGGAACTAGT
GAGCTAGTTAACCATGTTCCTTCTTTTACCAGGTTAAAGACTTCTATCCTCTTCATCCTT
TTAAAAATCATATACTTGGCAATTGACCACTTTTAGAAAAACAATCCAGTCAGCCAAATA
ATCTTCATATGAGAATAGCATGTTATCAGCAAAAATCTGACTTGTAAGAAATAAAACTAG
ATAATGAATTTCTAGCTTGGACTTTGATTTTTCAAATTATTTCCAGCCAGGTGCAGTGGC
TCACACCTGTAATCCAACACTTTGGGAGGCTGAGGTGGGAGAACTGGTTGAGCCTAGGCG
TTTGAGACCAGCCTGGGCAACAAAGGGAGACCCCATACATAAAAAAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved