Homo_sapiens Locus Mono:244:AC008083.23
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:244:AC008083.23
Homo_sapiens
Mono:244:AC008083.23
12
SNORA10L1
1001..1132
2132
GGTGGCATTGACAATTTAAAAATGATTTTAAAATCAGTCATTTTCTAATTCTATTTAGT
AGTAACAGTAGCACTGTAGTAATTGCTGCAGTAGTAGCAGTTAACATTTACTGAGTTCTA
ACACATAAAAAACTGTACTAAACACTACACATATATATCATTTAATCCCCAAAATAGCTA
ATGTTGGAGGTATAATTTTACAGATGAGGAAATGAAATGGCAAGAGGTTACAAAATGTAT
CCAAAGTTAGAGGACTCAAACCAAATCAGTCTGATAGCAAAGTCACTGCTTTTAACTACA
ATGTCAGTGATCTCAAAGTGTGGTCCCCAGACCAGCAGCATCAACATCACCTGAGAATGT
GTTAGGAATGCAGATTCTCAACCCTCATCCCCATCAGCTGAATCAGCAACTCTGGAGGTG
GGGACACATTTGTCACATTCTCTCTAGGTAATTCCAAAGTCCACTGACATTTGACAACCT
CTGTACTATGCTAAGCTGCATTTAGAAGAAGTACCAAACACTGAGTAAACATTAGTTGTG
CAATTAAGCAAATGCGATAACAGGAGAGAACTACCCAGCACAGCACAGAGCTCACAGTGA
GCAGTAGCTTATAATAGTTTATTTCTGTTATATTAATACCCACCACATCTGTCTATTGTG
AAGTTAGATTATTAAAAACTGTTCCTGAACTGCTATCTGCATTCTAAGTTGGGAGGGGAG
AAGCCCAGCACACTGTACTTAGAAAGAAATTATCCTTCCGGGCCAACGAAGATCTTGAGC
AATTGTTTTTTAGCTAAAAAACTAATTCCACATTTTGTATTCATCAAAATGCCCATTGCT
TTATCTGGATTTGAGGGTAGGAGAAATCCACATATTTGACAACATTCCTTTGAATGAAAC
TAAGAAGTAATGTTGGTAGTGGTGGCCTGAGTGATACATGTGATTGTGGCAGAGATTAAT
GGTGACCAAAGAAACTTAACAAGTTTTAAAATTATAAAATAGGCCTCTCAGTGCCGCTTA
ATCACACAGGTCCAGTGTGTGCTTGGTGTCTTTTCTGGGAGGCAGAGGAAGGCTCTCCTA
ATCACAACAGACCTGCCCAGAAGGGCCTCTCTATTTCTAGGAGTATGATAGCTTTTGGGG
GGAAAAAAAAGAAAATAATGGATGCTGCCGGGTGCGGTGGCTAATGCCTGTAATCCCAGC
ACTTTGGGAGGCTGAGGTGGGCAGATCACGAGGTCAGGAGTTCAAGATCACCATGGCCAA
CATGGTGAAACCCCGTCTCTACTAAAAATACAAAAATGATTTAGGTGTGGTGGTGGGCGC
CTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCGCAATTATCATGTATCAATA
AAAATTTTATTAAACTATCATTCATAGCATCCATTCTTTTCTTTCTTTTTTTTTTTTTGA
GACAGAGTCTTGCTCTTGTTGCCCAAGCTAGAGTGCAATGGCACAATCTGGGCTCACTGC
AACCTCCGCCTCCTGGGTTCAAGTGATTGATAAATGATAATTGTACATATGTATGGGATA
CGTGTGATATGTATTAAACATGCATACAATGTGTAATGATCAAATCAGGGTAATTGGGAG
ATTTGTCACTTCAAACATTTTTTTATTTTTTATGTTGGGAACATTCCAAATATTCTCTTT
TAGCTATTTTGAAATATACAACAAATTATTGTTAATTATAGTCACCCTACTATGCTATGG
AACACTAGAACTTATTCCTTCTAATTGTATTTTTGCACCTTTAACCAGCCTCTCTTTATT
TCCCATCCCCAACCTTTCCCAGCCTCTAGTAATTATTATTCTACTCTCTACATCCATGAG
CTCAATATTTTTAGCTACCACATATGAGTGAGAACATGCAATATTTCCACTTCTTCTACC
CATTATTCTGGGCCTGGTTTATTTCACTTAACATAATATCTTCCAGTTCCATCTATGTTA
ATGCAAATGACAGAACTTCATTCTTTTGTGGCTGAATAGTATTCCATTGTGTATATGTAT
ACAATTTTTTTTAATCCATTCATTGAGGGACACTTAGGCTGATTCGATATTGTGACTTTT
GGGATTGCTGAATTGTATGGCACATCTATCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved