Homo_sapiens Locus Mono:227:AL162255.17
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:227:AL162255.17
Homo_sapiens
Mono:227:AL162255.17
1
SNORA63L7
1001..1119
2119
GAAGGTATATAGGAGTTCTCTATTTTAAATAATTTTATATGTCAACTTGACTGAACCAC
AGGATGCCCAGACATTTGGTCAAACACTATTCTGGGTGTGTCTTTGAGGGTATTTCTGGA
TGAGATAAAAACCTGGATTAGTAGACTGAGTAAGGCAGATTGCCCACCCAATGTGGCAGA
CCTCATCTGTTGAGGGTATGAATAGAACAAAAAGGCTGTAAGAGGGAACTCTGCCTGCCT
GAGTGCTTTAACTGAACATTGGTGTTTTCCTCCCTTTGGACTCAAGACTGAAACAACAAA
ACTCTTCTCAGGTCTAGAACCTGCTGGCTTTTGGACTAGAACTTATACCACCGGCTCTCC
TGCTTTTCAGGCCTTCACACTCAGTCAGGAATTACATATTAACTGTTTTGGGTATCCAGC
TTACCAATGGCATATCTTGGGACTTCTCAGCTTCTAGGATCATGTGAGCCAATTCCTTGT
AATATATACTATATAAGAAATTATATAGTGTATGTAATTATATAAGGATTATATATATAA
TAAAATATATATACACATCCTATTCATTCTGTTTCTCTGGAGAACCCTAATACACTGTAA
ATTCTCCCAAATTATACAGAAGCTCCTCAACTTAAAAACCTTCAACCTGCAGGCTGGGGC
ACGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGCGGGCGGATCACGAGG
TCAGGATATCAAGACCATACTGGCTAACACAGTGAAACCCCGTCTCTATTAAAAATTAGC
CGGGCGTGGTGGCGGGCGCCTGTAGTCCCAACTACTCGGGAGGCTGAGGCAGGAGAATGG
CGTGAACCCAGGAGGTGGAGCTTGCACTGAGTCAAGATTGCGCCATCACACTCCAGCCTG
GGCGACAGAGTGAGACTCCATCTCAAAAAAAAAAAACCTTCAACCTGCAAATTTTCATAG
AAACCAACAAAGCTACACATCCAATAGACAGTACAACTCTAATGCAGGTACTGTTATAAC
TGAAGTGTTTTACGGTTTTTTCTTCCTGCTTAAAGCACTTGGTACATAAGTATCTCTAAC
TCGATTCCATAATAAGACAGAGACGCTTGGTCTCAAACATTTTTGTTTGAGTATTACGGT
GAACATTACGCTACAACATAAATTTTAAAAGAAAAAGTACAACTGTTACCACCAACAGAT
GGCGTTAGTGATCACTTGTTTAGCATCAATCTGGACTTGAGACAAAATGAGCCGAGGAAC
AGCTTTTTGGACCTAAGCTCATATATCCATAAATTTTTGCCTCATGCTAATAATACAGAT
GAATATTATTTAGGAGATGGAAGATATTTTAGAGATCTCAACTTAGGGTGCATTTCAAAC
CCCCAGGTCTTCTCTAATTTTAATATTTGACTTGTCTCAGGGCCCATGTCCCACCCCCAA
ATACCATAGAGAATCATGGCTGTAGGAATTCATTGTAAAGTGATGAGAAAGTGTTGTATC
TTTCAAATGTGTAAGAATGAAAGAATACGAAGGCAGGAAAAAAAAGGACAAATTTGCTAA
CCCACTGCTTTGTTCCAATCCTGATTTTACATAAGACAACATCAATCCAATGCCAAGGTC
ATGTGATCTTGCCAAGTCCACATAACCAGTATGGCACATTCAGTGCCTCGTATTCAGTGG
ACTACCAGTAGTTCAAGTACAGTACAGAGGGCAAATGTAAACAGAGGTGGGAAGCATCAG
GAACTGAGTCTGAAGAAATAAAGGGCAATGTTTGTCACAATAACAGAAAAGCCTGGACTG
TACACAATGAAAAGGCAGAGTCCATATTAATGAACTATTAAATTGTATCTTACAAATTCC
ATTCAGGATACATACATAAACAGAAAAAGAGAGAGAGAAAGACCATACTGAATTCAGAAG
TCTCAACAAATGGATACCTAAGCAATGACTTCCCCTACAACAGACCCTTGGTATCAGTTT
ATTAAGTATTTTTTCCAAGGCAACTTGAAAGATTTCCAAATTGGAGAATATTACTATGGC
ATATAAAACATTAAAGTATAACTATTTTTTAACTCCTTCAGACCTTTAATGATTCTAAGA
AGATTGAAATAATTTATACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved