Homo_sapiens Locus Mono:189:AC006023.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:189:AC006023.2
Homo_sapiens
Mono:189:AC006023.2
7
2062
AAAAAAAAAAAAAAAAAAGAGTAAGGCTAGAACATAACATTTGTGAAGAACTTAACAGT
AAAAGCTTACTTTTTACTAACTTGCTTGTCTATCCAAATGCTCTAGAATTAAACTGATGC
TACAGACGAGTTTTCAAAATAGGTAATCCTGGCATAGAGCGGCTCATCATTTATCAACAG
AGTTGCGAATAACAACTATCAAAACTGCCCACAATTCCTAGTCAATTCTATCTTAAAGTA
ACTTCATACAACTGATAACACTAGAGAATAACTTTTGCTTAAAGATACAAATATTTGGTT
TATAAATGCTTTCTTCTTACCCTAATTAAGTATTTAATGGAACGTTACTGTTGTACCTAT
TTTAAAGATGAGAAACTTGAGGCTTAGAAAGGTGAATAAACTTGCCCAGAATATCTACAA
ATTCCCTTAAGCAACCCCACCTGGTAATATATACCTATAATCCTCAACCTGGATCTGTTT
ACCTCTAGGAGGTACCCGAAGACTCTCCAAGAGGGTACACCTGGAATTTTTTTAAAGGAA
TTTCCATATCCATATGTCTGCTTTCCTAAGACTGAGCTTTGAGGATGGCCTGCTTGTTTA
AGCAAGTTCTTTTACATCTCCTCTTTCACAATTAGTCATGTTATAAAATAAAGGCAGATG
CAATAATATGGTTGAATCTTAGCAATATTAGTTTAAAAAGTCATTCCCAAAATATTACAA
ACAGCATGACGCGCTTTTATAAAATTAACAACTAAAATTTTTAAAATATAACCTTTTATG
AGTACATATAGATGGCAACAAAAAGTATATACAAAAGAAAACAGGGATGATGGTTACCTC
AGGTGGAGGAAGGCAAGGGGATAGGTTGGTGGGGGTAGGGGTAATATGATTACAGTATGT
TATTTTCAGCATTCTAGCTTTTGTTTGGTAGGTTCATGGCTGCTTATTAACATTATTAAA
AATAACTAAAGTAACTAAAATAAATAAAAGAGAGCCATGCATGGACCAATGATGAGTGAC
ACAAGGATTATGATTAAACCAAGTCTATGCACCTGAGGTCCAAAAACAAAACAAAGGCAT
ACCTCTCAGCCATCTTACTATGATGCATTGCCTCAGCGTGTAAAAACCTCCTGGAGTAAC
AAACAAAGGGACAATTTGAAATATCGATATTGGGAAGCTTTCAGGCATCATAAACCCGCC
AAAGAATTTCCTTTCTAAGTGTTTGTATGATATGATGTGGGTCTCAGTCTCTGTTGGGAT
ACCTTAAATTCAGATATACTGTAGTACTGCACAGTGGGGTAACTGGAGTGATTCCACCTT
TCTATCCTGAAGCTCAGGGAATGCATTGCTCTTGAAGGACAGCCCCATGAGAGCAAAGCA
AAGTAATCCATTAAAAAGGGCTTTTGTTCCCTCCCACAATTTAAAAGTAAGAGATTATTT
TCTTTCCTTTTTTTTTTTTTGAGATGGAATCTTGCTCTCGTGCTCTGTCACCCAGGCTGG
AGTGCAGTGGTGCTATCCCGGCTCACTCCAACCTCCGCCTCCCAGGTTCAAGCAATTCTC
CTGCCTCAGCCTCCCCAGTAGCTGGAATTACAGGCACATGCCACCATGCCTGGCTAATTT
TCGTATTTTTAGTAGAGACGGGGTTTCCCCATGTTGACCAGGCTGGTCTTGAACTCCTGA
CCTCAGGTGATCTGCCAGTCTTGGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCTACC
GTACCTGGCCCCCTTAAAAGTAAGAGATTCTTTATGGATGATCTTAATACTCATCTCTAG
GAAAGATAAATTTTACCCAAGAAATAGCTAAAATAGTACAGGTTACTGATGCTGATACTT
TCAGATGGATCAGGAATGTCTTCCAGATAACCAAACTTTTATTTGCTTTCTTGAAGGTTC
AAATGCCAGCTCAGTCACTTACTTGATGTGTCTTAGGCAAATAACTGGACCTCTGTGCCT
CATTTTCCTTGTCTTTAAAAATGGGATTAACAATACTATCTACCTCATGGGGTAGTACTG
TATGTTAACATGTGCAAGCTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved