Homo_sapiens Locus Mono:30:AC016907.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:30:AC016907.6
Homo_sapiens
Mono:30:AC016907.6
2
SNORA10L2
1001..1133
2133
GTGGTGGTGGGTGCTGAAGAGGATGGAGGAGACATGAAAGGTGGAACCAAACAAAAGAA
AACCATGAAAAACAGCCAGCAGGAATGATAGGATCACATGTATGTGTTTATGTAAAAACG
AATAAGGGGTGGGGAATTTAACTATGTATTGCACCTCTACTTTCTCTAGCCCTATCTCAG
GCATTGTAAAGAACAGAGGACAGCTCTGTTGGCCGGAAGCTTACACTCCCTTTGGGAAAA
CAAGGCAAACCCATGCAGCACTCAGTGAGCAAGCCAACATAATTCAACGTTCGAATTCCC
TATCTCCTGAGTTCCTATCACTCTATTATATTGTTTATTTAACAAGCATTTCTTCAGGCC
ACACTAGGTGCCAGGTGTGATCATTGTCCCTGAGGAGTTAAAAAAGCAATATAATTAGAG
ATGGATATCTAGTGCTAAGTAAATATTATCAAATGGGGTTAAAATAGCTGTAATTTGGAC
AGAGAGAGGTGCTGTATGATATTTTGTCTTTATAGCCTTTGTAGTCCATCACATCAGTAT
CTAGGGCTGGAGAAAGACCTTATCACCCATCTAGTGTAACTTCTATATATTAATTATGAG
GAAACTGAGGCCCTGGGGGAGCAAATGAGAGTAGTCCCTTCCAGTGATTAGCAGAGCTGA
GCTACAGCCCACAGCTCAAGAACCAGGCTTGTTTCTGTCCACCACACAATAGTGTCTTCA
AGCAAAACTAAGAACAAATAATGTCTGAGAGTGAAGGATTTGATGTTTTAATGATCTTTC
ATCTGAAGCAGCAAATATAATAGGGAAAATATGGTGCTATAGGTTCAATTGTCTCCCCCC
AAAAGATGTATTCAGGTCTTACCCTCTGGAACCTATGTATGTGAGCATATTTGAAAATAG
AGCCTTTGTGGTATCGATGACTGCTACACCTCAGCCCGGGGCTGCACTGCCACCCTGGGC
AACTTCAGTAGGTAGGTGGTCCACGCATGGGGCATAGCCATGGTCTCTCAGCTCTGCTTA
ACCACACGGGTCCAGTGTGTGCTTGGCGTGTTTTCAGGGAGGCAGAGAAAGGCTCTCCTA
ATGCACGACAGACCCGCCCAGAATGGCCTCTCTGTTCCTAGGAGTGTGACAATTTTTGGG
TTAAAAAAAAAAAAAAAAGAAAATAGAGCCTTTGCCTATGTAATGAAGTTAAGATGAGGT
CATACTGGATTGGGGTGTTTCCTAAATCCAGTATGACTGGTGTCCTTATAAGAAGAGAGA
AATGTGGACACAGAGATACAGACACACAGGGGAGAAGGCCACACCAAGATGGAGGCAGAG
ATGGAATGCTGTATCTGTCTGTAAGCCAAGGAGCTCCAAGGCCTGCCAGCAACCACCAGA
AGCTAAAATAGGCAAGGACGGATCCTTCTCTAGAGCCTTTGGAAGAACATGACCCTGTAG
ACACCTTGATTTTAGACTTCTAGCCTCTAGAACTGTAAGATAATATATTTCTACTGTTTT
AAGCCATGCTAATATACATCGCTTGGAGTTTGTTAGATCTAGGTAAAATCTTGTTTTTGT
TATTTACAAGACGGATGATCTTGGACAAACCAACAAACTTCGTTGATCCTTGGCTTCATT
ACTGTAAAACAGGGATAATAGCAGCACCTCGGTTGCTGTGAGGATAAAACAAGGTAACTC
ATGGACAGCACCCAGCTCCTAACCACTCTACTGAACTCTGGGAAAGGAAATGGACCAGGC
TGGGCTCGGGGAAGGTAGCAGGCTCTGAGTCCCTCTTCCCCTGAACCTCATGATGCCATG
TGGAGCAAGGCTGGCCAATTCATCTTTTTGGCTGGAATTAACCTACAGTAATGGCTTGCA
TGCTGTAGAATAGCTATGCTGTTGGCTGAAGCCTATCCCTCCCTGACAGTAACAACTTAA
TGGTCTAGAGAGTGATGCTGAGGCAGGAGAATGGGGTCTGGAGGGAGGGAACATAAAGCC
AATTCACACTGACTTCCTAGAACTCAATCAAATAGAAACACTTCAGCTATGACAGGAAAT
ACCCTCTCCATTTACATAGGGCGTACACCAACTAAATGACTTTGTAACTTTACTACATTC
TCCTCATTTACATAGAGTGTACACCAGTGAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved