Homo_sapiens Locus Mono:181:AC004879.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:181:AC004879.2
Homo_sapiens
Mono:181:AC004879.2
7
SNORD3L3
1001..1214
2214
TTATTCAATGCTTTGTTGTAACTTCGTGTATCTTATTCATCAATCACATCTAAACCACT
GGGGTTCTGACAATAACAAATATGGAATGTATCCCATTTTCTCTCTATTGTTGTTATAAG
GAAAGCAATATAGAAGAAAACAAGCTAAGCCAGTAAGTCACAAAATAAAGTGAGCAAATC
AGTGTGACCGGAAGTGGGACAAATCTCTTCAGGAGTCCAAACTCTTAAAATCAGATTTTT
TTTCCTAATTTGGGAATTCAGCTTTACTAAATCTAAATGCTTAAGTCTTTGCCCTCAAAC
ACAACACCTTTTAATTTGTTATTGCTGAACATTATAAATTCTGCAATTATAAATTCTGCA
ATTGCTAATTCTTGTTGAGGCTCACCCTGCATGGACCAGACATAGTGGGAACTGATTTCC
ATGTAATGTATGATGTACATCCTCTAGTAGAAGTCAAACTTTTTATTTACTGTTGTAGTG
TCACCCCGGTAGTAGCAAAGTGCTTTGTAATAAATTATTACTAAATTTTAAAAAAACTAA
TAATAAACAAAAATTCTAGATTGCCAAAATGATCTTCCTAAAATTGTCAAACTGATCTTA
ATCTTTTTCTTTTAAATAAATCAGTGTGTAATGCATAATATTTTATGTTTTAAAGAAAAT
TAACAAAATAAAATTACCAGGATATGTTATCCCACAGATGCACAGCTAATGAAATAATAT
GAAGAAACTTTTAATAAAACTGTCATAGAATATGTAGGAGATAAACTACACATACACAGC
AACTAGGTAGAGTCAAGCACATAAATAAACCAAACAAATTATACTTTATGAATTTAAATT
GTACAAGAATAAAAAAGGTAATTAGAGCTTTAGAAGATGAAATATAATCTGGGTATTATA
ATATAGAGTAAAAAATAAAACAAAGTTTTAAATTATGAGAAATGGAAGATAATTTGGGAA
TAGAATGACCAGACAAAATATCTGATTAAAGAAGTCTCAGAAAGATGATACTTTCAGTGA
TCTTTTTTCAGTTTATTACTAGAAAAGTGTCTCTGAACCTGGAGAGCACCAGAAACCAAG
AGGAGGAGATGTAGCGCTCTCTCCTGAGCTTAAAGCTGGCTCTTGGTTTTGCTTTGCTGC
AACTGCTTTTTGCCATTGATGATCATTCTTCTCTTCCTCCTGGGAAGTAAGAGAGAGAAG
ATGCAGCACGAATGGTTCTTTTTTCCAATTTTTTTTTTAAAAAAGAAGTTTTTTTAAAAG
AAGTTTTGAGAAAGAAAAAAACTTATGGAAAATAAACAAGAATTGAAGAAATAATAAATC
AAAAAACATATTTATTTTGGATGGAGACTAAAACTTGAGTGCCAGACAGGATTCATTCCT
TCAGTTGTTCAGTCTCTCAACAGATGTTTATTCAGCAAATATTGTATGCCAGATGCTGTT
GTAAGTGCTAGGGATATGGCAGGAAGTACATGTTGTTAGGAGGGAAAGACAGGCAAGAAA
CAATAAGTACTAGATTATGGAAAGACACTGTTTTAGTCTATTCTCGCAGCTATAACAGAC
TATCACAGACTGGTAAATTATACCGAATAGGAATTTCTTTCTTTTTTTTTTTTTCCTGAG
ACAGAGTCTTACTCCCTCCCCCAGGCTGGAGTGTAGTGGCGCGATCTCAGCTCACTGCAA
CCTCCGCCTTCTGGGTTCAAGCAATTATCCTGCCTCAGCCTCCTGAGTAGCTAGGATTAC
AGGGGTGCACCACCACGCCCAGCTAATTTTTTTTGTATTTAGTAGAGACGGGGTTTCACC
ATGTTGGCCAGCCTGATCTCGAACTCCTGACCTCGTGATCCACCCGCCTCAGCCTCCCAA
AGTGCTGGGATTACAGGCATGAGCCACCACACCGGGCCAGAAATTTATTTCTAACAGTTC
TGGAGCTGGGAAGTCTAAGAACAAAGCACCAGCAGATTTTGGTGTCTGGTGAGGGCCTGG
TCTCCACTTCCAAAGTGGTGCCTTTAACCCTGAATTCTCTGGAAGAGAGGAACTTTGTGT
CCTCACGTGGCAGAAGAGCAAGAGAGAGCAAATCCACTCCAGCAAGCCCTTTTTATAGGG
GCATAAATTCATCTATAAGATCAGAGACCTCATGACCTAAACACCTCCCATGAGGCTCCA
CCTCCCAACACTGTTGCATTGGGGAAAACATTCAAACCATAGCAGACAGTACATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved