Homo_sapiens Locus Mono:294:AC087698.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:294:AC087698.5
Homo_sapiens
Mono:294:AC087698.5
8
SNORA51L11
1001..1131
2131
TGGAGCTATTTTTGAAATCCATCTACCTAATGTTATTATTTAAAATAAAGTTGTGTACA
TTATTCTCCCTAATTTTTCTTAAGTTTATTCACATTTATACATCTACCTTTTATAAAAAC
AAATGATGCTATAGATATTTACCTCCAGGTTTGTTGTGAAAATAACTTGATGTGATCAGT
ATCTTTCCAGTTAGTACATACAGCTAGATTTTTCTTTTTGATGGCTGCATAGGGTTTAAT
AAATCATGATGCCATAATTTTTTGAACCATTTACCTATGGATGAAAATATAGTTCACTTT
TTTTCCTATTGCAAGCATATCATTACAAGCACATGTTTGTATACTCATGGTTTTAATTGT
AAAGCTTTGTTTCCTAGAAGAGTAATTTCTAGTTGGAAGCGTGTGTACATATTTCATTTT
AATGGATGATATTTACCTTATAGAAAAGAGCTAGTATTGGTTATATATTTGTCATAGTAA
TTAATGTTAGTTGCTGGAACAGATAACCATAAAACACAGTGACTTAACACAAAGTCAGAT
ATAAATCAGGCTATCTTGGATCTACTCCATGTGGTGACTCAGGAACTCCAGCTTCTTCCT
CTACCACACGCCTCTGTCACCTCAGAGAATGGGCTCAGAGTTCCCTCACTAGATACTCTG
ATTCAATAAGCTATCAAGAAGATAGGGAGCAAACTAAGGAAGATAACAAGAGATGTTTTA
AGGCCAAGACTTGAAGTGGCTTATTTTCTTCCACCTATGTTACTTTGGTCAAAATTCAGT
CAAATCATCCAATCTAACTAACTACAAGGAAGGCTGGGAAATGTAGCTTTCCTGTTTGCC
CAAGAGTAGGAGTAGTATTGGCTAGCGTCTGGGCAGTGTGTGCCTCTGATGATGATATTG
TTTCTGTACACGATATTTCTATTATCTTTATTATTGTTATTATCATTTGAAAATCCTGAA
AAGCTCAAAAAGGAACAAGGAACAAATAATAATACCAGAACAGCCTCCTGGTGTTTAACA
CAGCTGTGTTCTTATACTGACTGTGTAGAAAGAGAAGGAAATAAACCTTACCCCATATGC
ATTTCATCCCCGGACCCTGCACCTCGTCTATATTGTGAATAGGGAAATATGGAAGACCAT
CGTTCCAGACCTTTTACAATTGGAAAATGAATCAAATATTCTCTATCCATTCCATCCCAA
CCCTAGAGGTAAACATTGCTAATAATTTGGAGTTTATCCTACTTGGTTTGTTTCTGTAAC
ATGCACCTACCTGTTTAGTAAGTATGTGTTTACCTATGTATACCCCTATATGTTATGAGC
TGAATTATGTCTTCCCAAACTTTGTATGTTGAAGTTCTAACCCCCACTACCTCAAAATAT
AACCATATCTGTAAACAAGATCTTTAAAGGGATACAGAAATTAAAATGTGTTTGTTGGTG
TGGGCCCTAATCCAATATAACTGGTGTCTTTCTAAGAACAGATTAGGACACAGGCATAAA
GGGAAGACCATGTGAAGACACAGAGAGAAGAAAGCCATCTACCAGCCAAGGAGAGAGGCC
TCAGAGGAAACCAGCCCTGCAGACACCTTGATATCCGACTTTTGGTCTCCAGAGCTGTGA
GAAAATACATTTATGTTGTTAAAGTCACTAAGTCAATGGTACTTTGTTATGGCAGCCCTA
GTAGACTAATACACTACACATAATTACACATAAAATATGTGATTTCAAACTCTTTCACAC
CCTTTCATAACTACCCATTGTACATAAATGTTTTTCCTCCCTCCTCATTTCTTTTCTTTT
TTTTTCTTTTCTTTTTTTCTTTTCTAGAAGTAAATCTTTTTTAAGTTTTTGCCTATATGT
TTAAAATTTGGAGGGCAGTGATTTCACTTACACTTTCTCAATTTCTAATGAGTATTAGAA
TTTTTCCACATTACTGACCATTTATTTGCATTTCACCTTTGGTAAAATAACTGTCATTTA
TCCATTTTTTAAATAATTTTTTTAATTTAAAGAAATTATTTATATATTATGAATCACAAT
ACACTGTTATATAAGTTGCAAAGGTTTTCTCCCAATCTGTCATTTGTATTTTGACTTGAC
TTCGTTTATGGAATGGTTTGATTTATAGATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved