Homo_sapiens Locus Mono:12:AC016394.13
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:12:AC016394.13
Homo_sapiens
Mono:12:AC016394.13
10
SNORA11DL1
1001..1128
2128
GAGGTTTCACTATCTTGGCCAGGCTGGTCTTGAACTCCTGACCTCGTGATCCGCCCACC
TCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCATCGCACCCGGCCTTAATTTTTG
TATTTTTAGTAGAGATGGAGTTTTGCCATGTTGGCCAGGCTGGTCTTGAACTCCTGACCT
CAAGTGATCCGCCCACATCAGCCTCCCAAAGTGTTGGGATTACAGGCATGAGCCACCGTG
CTCAGCCCTAAATCATATTTTACACATGTTTATGTAATCTAGATGATGCTGGACTAGACA
AGTGCTTAATAAGTACTTGCTGATGAGCAGGTTGGATGAAGCAAAAGAAATATCACAGTA
TAAGGGAAGATGAGAACTTACTTCTGTCTGCCCTGGTTTCACAGTTGCATGGCAAGCAAT
CATGAGTGAGCCACTAGGGAAGGGCCAATGCTGGGATGCATAGTACTGCAGGCTTTCCAC
CTCCAATCCCACCTCTTCTGCAACTTCTCGGCGGATGGTCTCTTCCACACTTTCACCTAC
AAGCACTCAGATTAATTCAGGACAGCCCTGTAGGCTAGAAGGGTGATACAGACAGCCCAT
TTGAGAAAGGTGCACAACACTGGCTCCAAAGTTTCAATGAAATGCTCTTGGGAGTGTCCT
AAAACTCTGAGTCATTCCAACAATAAGAATCAGGTCCAGAGCTGTGTGTTGAACCACAGT
GCTTAAGTCTGCTAGGTCTAAAGTAAGTGTGACAGTAGGAGGGACTACTGCACTCAGCTT
TCATAAAATTCCACTTTTCACCATTTGCAAATTTGACCCCAATAGACTAGAGAAAAAAAC
CAACCTGTAAATAAATACTGAATTCTAGCAAATGTTACGCATGCTGAAATAGGAAGAAGT
GTACTAATATCTTCAATCTATGCATCAAAAAATAAGATAGATTAATGGATAGATGGACAG
CTTTGTGATAAAGTAAGTGTAGTAAAAATTCATGGAATCTAGGGGTGTGCTCAGAGCAGG
GGGCCTAAAGAATGGCTCCTCTGTTTATAACACACCCAACAGGAATCTGGGGTCAATGTG
ATGAGAGGCACAAAGCTTGTGGCCTCCCTACAAACAAATGCCTACATGTGAAGAGGAAAA
AAAATTATAGAATCTGGGTAGTGGGTGTATGGGTGTTCACTGTATAATTCTTTCAACAAT
CTCCTATGTTTGAAAATTTGCTTAAAAAAATAGTGTGGCTCACACCTGTAATCCCAACAC
TTTGGGAGGTCAAGGCAGGTAGGTCACTTGAAGCCAGGAGTTCAGGACTGGCCTAGGCAA
CACGGCGAGACCCTGTCTCTACAAAAAATTTTAAAAATTAGCCGGGCATGGTAGCCTGTG
CCTGTAGTCCTAGCTATTCAGGAGGCTGAGGTGGGAGGATTGCTTGAACCCAGAAGGTTG
AGGCTGTAATGAGCCATGATTGCACCACTGCACTCCAGCCTGAGCAACAGGGTGAGACTC
CCATCTCAAAAAAAAGGAAAGGAAAAAATTTTATATATATATATATATATATATATAAAA
TGCCAGAAAGCAGTTTTCTTGACATGATAGAAAAGAATGTGCTTGGGAATTCAAGCTCTA
TAGCAACAAGACAGAGAAGATTGTATTAGTAAGATTGTATATCTTCCAGTGTCACCTGTA
TATCCCCTAAACTCCTCACCTATATCACAAAAACCTGCCAAGGCAGAATACATTCCCTTG
GGAAAGGAGCTTTGGCGGGCAAGCAGGCATCGGGTCCCATCTGACACCAGCGTGATCGCC
ACAGGAGCCATCTAGGAAAGGGGAATGGAAACTGAGATGCTGGCACTTTGGGCCCTGCCA
ATGAGCTAAAGCAGTGTATAATTAAGGAATTGCACAGGCTTCCTTCCCCAGGACAAAGCA
GCGCACAGTCTTCTTGGATTACTGTCCTCTTACAGCAATAATTACCTGTGGATAATAGAT
TATATTATTGGAAGGGCACACACGCTTGCTGCCAGCCACGTTCTTCTTGGTGGGCTGCCC
ACTTCTGCTGCAGAACTGATGAGCATCATGCCAGCGGAGAAGAGCTTGAGCCTAGGAACA
CAATGATGGGCCTGGTGTCATTTGGAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved