Homo_sapiens Locus Mono:216:AL359273.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:216:AL359273.11
Homo_sapiens
Mono:216:AL359273.11
1
SNORA2BL1
1001..1137
2137
GTTTATTCAGCTTTTTACTTGTTGTTAGGGCTGAGTGACAACTTCCAAGCTTCTTACAT
GCCAGACTGGAACTGAAAGTTGGTGTGTTACTTTTTTAAAGTATAAATTCTGGGCCTTAC
CCCAGACCTACTGATTCAGTCTCAAGGGGTAGAGCCCAGGATCTTTATCTTAAGAAATCC
TCACCAGTGGGCACCCATGTATTATGGCTTCTGAAGCATAATTTTATAAGAATGAAACAT
AACTCTGGAAACTCCTGTGAGAAGAGTAGCCTTGGCCCCAGAAACAAGGTAGAAGGGTTC
CTAAGCTGTTCATTATTAAGAGAGACACCCAATCAGGGATTTATAATTTGGTAGCTCTTC
ATCTACTCTCAAAGGTGCACCCAATAAAATGAAGGCCCAGCACCAATATCCCAAGACCAG
GCACAGGCAAGAGGAGATGGACACCAAGGTGCTGCCCTAGGTTCAAGGATGTTGTTGTTT
TCCTCACCCAGGAGGAGGACCTGCATCAGAGCAGTGGGAAACTTTTCTTTCTAGACTTCC
AGTTTCCACACCTGGCACGATTCTGGCTGGACCACAAGAAAGAGCTAAGGAGAGAGAGCC
CAAGAATACCTGCTTATGTGACAGCTGCAGTTTAGAGGAGTGAGGTAATTAGCTTAGGAT
CATCCAACCAGTAGGTAGGTAGATGTGAGATGATGCAAAAGAAGATATCAGCAGGAGTGA
CCCTCTGTCCCTATTGCATGAAATAAGTATGCTTTGCTGTAGAAAAGAAGGAAACCAAAC
AAATCATTAGTACCAATCTGGAAATGGAAAGAAAGGGCATCCCCATGACACCACTGGCTC
CCTGGACTGATACCTTCCAAGGTCAACCCCACATCTCTTCCTCCTACTCTTGTGAACCAA
TAAATTATCTTTTTTGCTTAAAGTAGTATATGAGTTGGGTTGCTATACCTTGAAGCCAGA
ATGTTCTAGTAAAAGTATTCCGTATGTATTAAAAAGAATGGTTGGTCCTGATTCAAGGCC
AGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGAGACTAAATAATTGTCTTTTCATGGTC
TGTTGGCCATCTTATAACTTTGGAAATGTAATGTCCAATTCATTAGAAATAAACATCTGG
AAAAAAAAATGGACAAATATACTGATATAGAAAATGATCACAATAATTATTAAATGAAAA
AGGTCAAATTACGCAATAGTGTTTTTGGTAGTATTCTATTTGTGTATACAGTGTGTTTTG
TGTGATTTTTATGTTGCCTTATTTTATTTCATCTTATTTTGTTTTTAGTAAATGACTAGA
GAACAACTGGAAGAATACTTAACACACTGCTGGCAGGAGATGGGATTGGGAAATCCCCCA
ATTCTGAACCATTTACTGATGATGAGCATGTATTACTTTCATAATAAAATACTAAATTAA
AAAAGGAAAGAGAAGAAAGTTAGTCACTGAATGTACCAGATACTTGCCTGCCCCCAACTT
CCTGGTTTCCTTGTTAGGGAGAAAAGATAGTTAGAGATAGCAAACAGAACAGGTTCCATG
GTTAAGCCAACCAAAACTATATTGACTGAGTCAGTAATTCAGTGAGATATGGACAGACTT
AAGTATGTACAACTGAGAGAGTTTGCATCACAGGGAATTAAATGCCCAAAGTCTAACCAG
TCAATAAAAATACAAAAAGGGTTAAAAAAGCAATCATTCATGTTGAATCCTCACAGTCTA
GGGGTGAGGAGTGCAGAATCCTACTCAAGGTACTGAATGGAGACTTGGCATCAACTGTCT
AGAATTTAGAGGGAGGCTTAGCAGGTGCTCAGAATGTGCAGCATCACCACTTCCAGTTAT
GTGGGCTGCAGAAAAGCCCCATTAAACAGTCACTTAAAAGGGAGATATTAAAGGAGAGGA
GTGCCTGGAGAGGAAGCAAAGAGGGGTTTAGCAAGTCAATGTAAGTTAAGAAGGCTAATC
CAGGCCGGGCGCAGTGGTTCACGCCTGTAATCCCAGCACTTTGGGAGACCAAGGCCGGTG
GATCACCTGAGGTCTGGAGTTTGAGACCAGCCTGGCCAACATGGTGAAACCCCACCTGTA
CTAAAAATACAAAAAATTAGCCGGGTGTGGTGGCAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved