Homo_sapiens Locus Mono:164:AC138972.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:164:AC138972.8
Homo_sapiens
Mono:164:AC138972.8
3
2091
GAGAAAGGGAAGGATGGAAGAGATGTTTCTGACATCCAAGGGCTGGCGTCACTGAACAA
AGCCAGAACCATCATGGGACTGTTTGGGGATAAAGCCTTTGCCAGAAAGACTTCTGAGGC
AGACATGGAAAGGGAGAAACACCTTGCCCTTCCTCTTGCCCCATAATCTCTCACTGATGC
CTTCTGTTGACTGAATTTCACTGAAGCCAGCTGACATGGGAGCCTGGGAAGCAGCCTAGA
GGAGTGAGCCCTGTGATACAGAGCAGAGCAGAGCACAACAAGGACAAAATGTAGAGCCAA
GGGCAAAGGAAATCCCTTTCATGAGTTATAACCTTATAAATTATGGCTGAACTTTTTTTT
TTTTTTTTTTTGAGACAGGTTCTCGATCTGTTACCCAGACTGGAATGAAATGGCAAGGAT
ACTGCTCACTGCAGCCTTGACCTCCTGGGCTCAGGTGATCCTCACACCTCAGCCTCCCAA
AGTGTTGAGATTATAGGTGTGAGCCACCACACCTGCCCCCACCTACCTTTAAAAACCCTT
ACTTGCAAGCCATCAAGAAGGTTGGATCTTAAGCATGAGCTGCCCAATTCTCCTTGCTTG
GTGCCCTACAGATAAACACTCCTTTCTCCCACCACAAACCTTGGTGTGGGTATTTGGCCT
TACTGTGCCAGGTGAAGGGACCCTGGTTCAGTTAGACAACATAAATATTTGCAGTGCATG
TGTACTACCCAAGTACATGACTTCATTGACAAATAAGTATAATCCCAGGGCTTTGGGAGG
CCAAGGCAGGTCAAACAAAATTTACCAGACTTGGGTCCAACGGTTACTACCACACTTTAA
GTTAGCAAATAGCTTTCCCTTGGAAGCTTGATTTGAACAGCCAGTGAAAGAGAAGCACAG
TTGGGCCAGGGGCTTGATGTCCCTGGGTATGTTACTGCTTTGGAAAAAGGGGCAGAAATT
TATGCTTTTGCACCTTTGTAGTACTTCTTGGTAACAGAGTGTTCCTGTGATGAATCAGTT
GCAAAACCATTTGTAGTTTCCATCTAAATCTTGATTATGGGAATAATAACACCTTGATTT
AACCCTCAGGGACCTAGAAAGAGTCACATCTAGAGTCCAAGAACTCTTTTCAAGTTCTAG
TTCTAATACTTACTAGCTGAGCAAGTTGATCTACTGATTTACTTTTCAGAAATCAAAAAA
AGCCGCACTTTCCTTATCTATAAAATGGGTATGAATATCCTTATCACAGGGATGTTAAGG
ATAAAAAGAGAAATAATTGTACAAACTCTGTATGAAACCATCAAAGGCCATACAAAAGTA
AAGACTGTTTAACACCCCGATATAGTGAGGAATTATATTTTAAAGTTGTGTGGTTACAGA
TATCATAGTGCTTACTACGCATCGGACGCATATACAAATCAATGGAAATACAATATTGAT
AATATTTAAAGGCAGAATTTGGAGATTACAGTTAGGGTGGTGGCAAGGGGATTCATGCCA
AGAGATTGTCCCCGAAGTGTAATAGAAGATTTGAAAGATGTTAGTACAGTCTTTTTTTTT
TTTTTTGAGATGGAGTCTCGCTCTGTCGCCAGGCTGGAGTGCACTGGCACGATCTTGGCT
CACTGCAACCTCTGCCTCCCAGGTTCAAGCGATTCTCCTGCCTCGGCCTCCCGAGTAGTT
GGGACTACAGGTGCACGCCACCACGCCTAGCTAATTTTTGTATTTTTAGTAGAGACGGGG
TTTCACCATGTTGGCCAGGATGGTCTCAATCTCTTGACCTCGTGATCCGCCTGCCTTGGC
CTCCCAAAGTGCTAGTAGTACAGTCTTTGGCAGTCAAAAAAGTCTTCTTGGGAAAATGAC
ACTCGTCCTTCCTTGGAAGGTGATGGCATTGGCTACACAAGAGTGTGTGGCCAGGCACAG
TGGCTCACGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGCAGGTGGATCACCTGAGGTC
AGAAATTCGAGACCAGCCTGGGCACATGGTGAGACCCCATCTCCATTAAAAATACAAAAA
TTAGCCAGGCATGATGCTGCATGCCTGTAGTCCCAGCTACTCAGGAGGCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved