Homo_sapiens Locus Mono:160:AC024060.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:160:AC024060.6
Homo_sapiens
Mono:160:AC024060.6
3
SNORA43L1
1001..1130
2130
CTACTTTTTAAATGATTAGTAAGATGCAATGAAATAGTTTTGCTAGAAAAAAAGTCAAA
ACAAAACCATTGTAATAACAACATAGTAATTTCTCAATGACACATGAACGCATTATTCTT
GTAAATACAAGCGAAATATTACAGTTAAACTCAAGTTCCCTTTGAGCACCATCTCCCCAG
AGGTCAATGTCGGACAGAAAATTCTCTAGAATTCCATATTGACTGAAAAATAGTGAATAT
GAATCACTTCTCCCTTTGTTTGACTTTATTGCACACCTAATATGTAGCAGGTGCCTGAAT
GTAGCCCCGAGGTAAAACTGAGGCTCTGAGAAGCTAAATGACTTGTCCCAGGTTGCAAAG
GCAGGAAGTGGAAGAACTGGGTTTTGAACTTAGTTTCCCTGACTCTCCACTCTGCCTGCT
CACTTCTTGTTTTACTAGGCTACTGTCTCCTGTTCTGTTGGTAATTTTATGGGAAACAGA
AAACCAGTACCCAATCCATGGTGCCTAAAAAGTTACTAAACATTCTTCCTTAAGGGAAAG
AATCATCCAAAAGTTAAAATATTCTGTGATGCTGTTTAACGCTGAACAATACACCCGGCG
CTAGCTCACAGGCATTCTTAGAGAGACACTATTCTACTGGTAACATAACATAGAGCCTGT
CAGTAATTTTATTTTTTTAATCCAAAATTTTATTTGATAAAGAAAATGCAGTCAAAATGC
ATATTTATTCTCAATAAGGATATCCATTAGAATAAACACTTACGTCATCTTCTTTTGGAG
CGTTTATTTTCACTTGATATTCTAGATTAACATTCCTTTGCTCTTGATCAGGATTTGGTT
TCCATTGTAAAAGAACTTGAGCCAAACCAGTAACTTTAATGGTGAAATTGACAGGTGGGA
GAAGTGAAACTGTTGATTCAAAGAATAAAGAAACAACACAATGTTCAACTGGACATAGGC
AGCACTTTTAAAACTTTTCGAATATTTATTGCCCTGCAGATGCTGTCCTGGACCTGCCAG
CACCACAGACACAGTTGCTCCTGCGTGCCTGTAACACCGGGGCAAAGAGAAAGTGGCTAT
TTCTACCCGAGTAGCTGGGACTACAGGCGCATGCCACCATGCTGGGCTAATGTGGGTTTT
TTGGTATTTTTAATAGAGACAGGGTTTCACCATGTTGGCTAGGCTGGTCTTGAACTCCTA
ACTTCAAATGATCTGTCCGCCTCAGCCTCCCAAAGTGCTAGGATTACAGGCATGAGCCAC
CACGCCTGTCCTAGAAGAGGTTTCTTCAAAACTGTTTTTAATATCTTTTTTACGTTGCCC
ATGTCCAGGTGTTTACCTATAATACCTATATTTTTATTGAAATATGAACATGTTACTATA
TCACTATTCACTATAACCATAATTTTCAAACTGAGAGTCATTATCCATTAACAGGCAATA
ATAACAATGTATTGGTTTGTGACCAGAATTTTTGTTTTAGTAATGTGGAAGAAAAATAGA
ATAGAAAATATCAGTGTGCATCAAACATAATAAGAGCTGTTTCATGAATCTCGTTTCCAC
TACATAAAGGTAGTTATATATTTGTATGTGTGCTGGTACATAATGTAAAAATGTATTTAC
CTCTTATTATGAGTCACAGACAAAAATATTTGCAAGCAAACTTACTTAAATAGGGCTTTA
CAGAAAGAAAAGGTTTCTTCCCCCTGCATGAGCCATTCTCTGACTTTGCTTTCAAAATTA
AAGCTTTTGTTTAATTACAAAATCAATATCTGTTTATTGAAGAAATTTTGGAAAACACAG
ATAAGCAGAAAGAAGAAAATAAATTTTTTAAAATAATTGTACCACTAAGAATGGAATTAA
CATATGATATATTCGTTATGTTTTTTTCTGGGCGTATATTTATGCAATTTTTAATTTTTT
TTACCACAATTAGGACGGTATTGTACACACAACTACAAAACCTTCTTTTATTCATTTACT
AAGTTATCAGGATTTATCCATTGACCTTAACGGACTTCCACACCTCTACATCCATGTTTA
CCACATGAGGACTTTTAGAGCTCTGTCTATATTGCATTGTCCATTACGGTAGCCACTGGC
AACTTGTGGCTATTGAAATTTTATTTAATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved