Homo_sapiens Locus Mono:220:AL137790.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:220:AL137790.4
Homo_sapiens
Mono:220:AL137790.4
1
AL137790.4
1001..1124
2124
CTCTTAAAGAGCAAAAAGCTAAGTATGGGAAGCAAGACTCATGTGAACCCAGATCTGTT
TGGACTGGTTTATTCCTATCCCAAATACCTGCACTTGTGTAGCCTCTGATTACAGGGGCT
TAAGCTTGTGAGTTCAGTGCCAGCAGACAACTTTCTCATTCTTTAGAAGGCCATTCCAAC
AAAAAGTGGGCTAGCTGCCTCTGGAAACATTTAGGTCCAGTTTTGCTAGGAAGCAAACAA
TCATGTGGGGGCTGTTTCTATTGCAGGGTGGGGAAGAAGGGGGTTGAGGTGTGAGGTTGG
GGAGGAGACTGTCCCCATCGCATGCTTTGGGAATCTTCCCTCTTGCTGCCAACTGTACAG
TGACTCTGAAAAGCATCTGAAAGAGGAGGAGGAGGAGGCTCCGTTCACACATGAAAGGCT
AAGACTCACTTAGGTTATAACACACACTCACCCATAATTACCCCATATTCCTCTAAATTG
TCCACACCATGATGGACAGATCCCCCCTTCCCGCCACAATTTTCCCTAAAGTTGTGGACC
TCTGATGACCTCGAAACTGATCTAACATAGTAATTTTGTTCTGGGGTACCTGGCCCACTC
CATCTTCTTCTGTGATCTGTCTTGGATTGTAAGCCCTACTGAAGGGACCAGCTGGACTGC
CTTATGTGTTCTATGTGACCATCCAGCTACAGCTGGTTGGACCAGAATCAGATCCTGTCT
CAATGTTGAACAATCTATTGGCTGGTCAGCAGCCAATCAGATTCACCCTCTTGAGAATTT
CAAGTATGTGTTGCACAGCCAGAATGCAATCAGAGCTCAAAGGTTACTGAGGGTTGGGAA
CTTTACCTACAATCAATGCTGTAAACAGGCTGAAGTCATTAAGAGGCAGAGATGCTTCTT
GAACAAGCTGCAGAGAGAAAAATGGCCCAAATGTATGAACAGATGAGACCATAGAGACAC
CATAGAGGCCCCAGAGAAAGAGAATCAAAGAGAGGGACTATAAGTCATTTCAAAGAGGGC
TTGGATGGCTATGAAACCAGAGCTCTTAAGGTTATAATAAGATTGAAATTTTCCATAGGA
TGCTGTAGTCACACAATAGTGCTGTTTTCTTGAGGAGACAGAAGACTTAGCCACTCATAA
TCATGACATCTCATTCATAATAATCCATGATTGGAGGTGTGGGAAAGTGAATAGGTATCT
TACAGTTAGGGTGAGAGAGGAAAAGAGAAAAAGAGGGGTTGGGGAGAGAGAGACAGAGAG
AGGATACCTTGAGCCCTAACAGTTCAGATTTCCCAGATGCAATTTTCAAAATGATACTGG
CTGCACTTTATTTCCATGAGCTGTCTTAGAACCTTACAATGACTACCTTGTTCATTTTGG
TTTGCTTTTCTGTCCTTTGCATGCAGTAAATTCATCCTAAAATTCATTTATCTAAATGTA
ATCTGATTTCCTTGTATTATAAAAATGCTCACTCCCAAGTCTCCAAGGGATAGTCCTGGA
GTTGGTTGTGGTGTCTATGTAAATCTCCGCAGTTCCCCTGACAATTGGCCTTGGCAGAAT
GAAAGACCATTAAGAAGCTGAGCAAGGAGAGGAAGGAGGAAAGCTTCACCTCTGTAACTG
CATATAATGTTTCCTGGAGAAAAATGGACCCAGGAGCTGAAAGAGGGCATCTAGTTAGAG
CTACAGAGTGCCTTTCATTGACCTGGTGTGGTCCCTAGAGAGAAAGTGCTGTGTGTTTCC
TCAACTGGTTCCTTTACTCATTTATTGTACATAGATATGGGCCTGACCCTAGGCTTGGTG
CTAAGGAAGCAGATAAATACAACACTAAACCTTCACTAAATCATGAGTTTCTGCTCATGG
TTTAGTGGAGACACTTTGGCATTCTATTGGTACTGCAACAAAACAGTCTGCCTTCTGTGA
GAGTTATTTATCTCTGTGTCAGTCTCTTCTTTGAGACGAAGAGTCTGGAAAGAACAGGGA
CCCTGGGTTATCATCTCTCCTTCCCTCCGCTGACACTAATGCCGAGCCTGGCACTCAAAA
ACTGACCAGAGAATTGGCTACCAGGTTTGGGCTGTGGATTTGAACTGTGTTGCTCCTCCC
TGCCCACTGATGGCCACCCTGGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved