Homo_sapiens Locus Mono:215:AL050343.17
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:215:AL050343.17
Homo_sapiens
Mono:215:AL050343.17
1
SNORA26L6
1001..1122
2122
TTTGACAAATTGGTGGAAGCTCAGTGCAGACAAGTCTGAAAGATATAAACTCCAGGGAC
ATGTAGTAATATGGGCAGGGGGGAGAACCACAGTTTTGTGAGTTTTACCTCCAGGAGCTC
AATAAGGGTCATCACAGTGAATACTGGGGGAAAAAAAATCCCCTAATGCGTCCCCTCTAG
GCTTCTTTGTAGGAGAAAGTATTTAATATATACCCAACTTCAGTCCTCTCTAGCCCTACT
CTCCCACTTACAGGATGGACTTGAGAAGCACATGTGAAGTTGACAAAAGTTCACTAACAG
ACTGAAAATGTTTCCCCTCCATGCACACCTTACCACCACATTACTAAAGGTCCACTCACA
GCAGTTTCTGTTACCTAATGCATCATGTATGGCTATCAAGAAAAAATTATAAGACATATT
AAATAGGAAAAAACACAGCTGGAAGAGACACAGTAAGCATCGAAACTAGACTTGGATGTT
GCAGGGATGTTGGAATTGTTACACCAGAAATTTGAAATAATTATGATAAATATCCTAAGA
ACTCTAATGGACAAAGTAGAAACCATGCAAGAACAGATGGGCAATGTAAGCAGAAAGACA
GAAATTTTAAGAAAGAATAAAAAAGAAATGCTACTGATCAAAAAGACTGTAACAGAAATG
AAGACTGCCTTTAATGGGCTTATTAGTAAACTAGACAAAGCTGAGGAAAGAATATCTGCA
CTTGAGAGTATCTCAACAGACACCTACAAAACCGAGAAGCAAAAGGAAAAAAAGACTGGA
AAAAAAAAAGCCTGGAACAAAATATCCAATAACTGTACGACAACCACAAAAGCATAATGG
GAACACCAGAAGAAGAAACAGAGAAAAGAACTGAAGAAAAATTTGAAACAATGACAGAGA
ATTTCTACAAATTAATGTGAGACATTAAACCGCAGATGAAGAAAGCTCAGAAAACACCAA
GCAGGATAAATGGCATAAAAATGGCATAGACACCCTTTCCTGTGCCCTTTTAAGGTTGAC
GCAGTGCTTTAAGGGGCTAACACAGAAGGGTAAAGGAAGTCTCCATAAACCCCAGAGAAG
AGATTGTAAAGCTCCTCTTTAGAACCTTTCTGGAGTCACACCTGAGAAAACAAAAACAAA
CAAGCAAAAAACCCTGACAGCTAGGCATATAATTTTCAAACTACTGAAAATCAAAGATAA
AGAAAAAAATCCTGAGAGAAGCTAGAGGGGGAAAAAACTCAACTTGCCTACAGAAGAGCA
AAAATAAAAATTACATCTGACATCTCCTCAGAAACTATGTAAGCAAGAAGAGTGGGCCAG
GCGTGGTAGCTCACACCTGTAATCCCAGCAATTTGGGAGGCCGAGATGTGCGAATCACGA
GGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGGAACCCCCGTCTCTACTAAAAATG
CAAAAAATTAGCTGGGCATGGTGGTGGGCGCCTGTAATCTCAGCTATTCAGGAGGCTGAG
GCAGGAGAATCACTTGAACCCAGGAGGCGGAGGTGGCAGTGAGCTGAGATCGCGCCACTG
CACTCCAGCCCAGGCGACAGAGTGAGACTCCATCTCAAAAAGAAGAAAAAAAAGAAAAGT
GGAATGAAATATTTCTTTAAAGTACTGAGAGAGATCAGGCACAGTAGCTCAGGCCTGTAA
TCCCAGGATTTTGGGAGATTGAGGTGGGTGAATCACTTAAGGTCAGGAGTTTGAGACCAG
CCTGGGCAACATGGCAAAACCCTGTCTCTACTAAAAATACAAAAATTAGCAGGCGTGGTG
GCGCACTCCTGTAATCCCAGCTACTTGGGAGGCCAAGGCACAAGAATCGCTTGAACCTGG
GAGGTGGAGGTTTCAGTGAGCCCAGATGGCACCACTGTATGGCAGCCTGGGCGACATAGC
GAGACTGTCTCCAAATAAAATAAAGGACTGAGAGAGAAAAAAATACCAACCTAGAATTCT
GTACAAAACTAAAGATATATTTACCATATGATCCAACAATGGCACTCCTTGGTATCTGCC
CAAGGGAGATGACAACATACATCCACATAAAACTTGTATACAATGTTTATAGTAACTTCA
CTCATAATTGCCAAAACTTAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved