Homo_sapiens Locus Mono:273:AL359396.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:273:AL359396.5
Homo_sapiens
Mono:273:AL359396.5
14
SNORD37L2
1001..1065
2065
AGTGAGAACATGCGGTGTTTGGTTTTTTTGTCCTTGCGATAGTTTGCTCAGAATGACAG
TTTCCAGCTTCATCCATGTCCCTACAAAGGACGTGAACTCATCTTTTTTTTGGCTGCATA
GTATTCCGTGGTGTATATGTGCCACATATTCTTAATCCAGTCTATCATTTATGGACATTT
GGGTTGGCTCCAAGTCTTTGCTTTGTGAATAGTGCCGCAATAAACATATGTGTGCATGTG
TCTTTATAATAGCATGATTTATAATCCTTTGGGTATATACCCAGTAATGGGATGGCTGGG
TCAAATGGTATTTCTAGTCCTAGATCCCTGAGGAATCGCCACACTGTTTTCCACAATGTA
AAACGACTGTTTATACAAGAATGGTCTGTAAGCCATCTGTATCAGACATGTAGTATGTGT
CATAAATTACAGGTTGAGGAGCCATACCCTAAGTCTACAAGGACAAAGACAGGATAATGT
ATTTTTACATACAACCCAATTTTCCTTATCCATTGTAAAGTTTGAGTAGCTCTGCTTAAA
CCCTATCATGGAGAAGAAGACATGATGAGATAGTCATTTTTCTGCTCAAAAAGGGTTATG
TGTTTGGCCAGCAAAACAGAAAGAGAATTGGAAGGACATAACTGATGTAGAGATAACTGT
TGTTCCCTGAGAAGGGTCCAGAACTCCAGCTGGGCTGAAAGGAACAGTTTGTGGCCAGTT
GCAGTGGCTCACACCTGTAATCCCAGCACTTTAGGAAGCCAAGTGGGGTGGATCACTTGA
ACACAGCCTAGGCAACATGGTGAGACCCCATCTCTACCAAAAACTACAAAAACTAGCCAG
GTACAGTGGTGCATGCTTGTCGTCCCAGCTACTTGGGAAGCTGAGGTGGGAGGATTGCTT
GACACTGGGAGGTCGAGGCTGCAGTGAGCTGAGATTGCACCACATCACTCCAGCCTGGGC
AACAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAAAGAGTTCATGATAAGTAACATT
TCTTCAATTTGACCTGATGTGTATTGAAGAAAACCAGCATCTGAGGCGCATGGAGAAAGA
AAAAGAATAAACTTGGACAAAGAAACAGACGTGCATAAAGGGAAGACAATGGAAAGAGAC
ACAAGGAGTAAATGGCCATCTACAAGAAGAGAGGCTTGGACAGATACTCTCTGCTCAGCC
CTCAGAGGGAACCAACCCTACTGACACTTTAATTTCAGACTTCTAGCCCCTGGTGTCATG
CAGAAATGGGATTTAGTTACAAAGTTTACAGTTTTCCAGAGGAAAGACAGCCTGGAAAGC
CAGACCCCAGTTCTTTGTGTTCTAGAATCCTTTCAAATTTACTCAGGATTTTCACTGCTC
TTTCTGTCACCTAAGGACATCAGTGGTGAATATAGCAGGCTACAGACTGACTTCCAAGAC
CAGGTGACAATTGCTATAGCTCAGCTAAAGGAAGACAGGAGCACAAATGGCAAACAAATG
CAATATCCCCCAGATGCCTGGAGCACACACATCCTGCTTATGTTTCCTGTGGGGCAGAAA
GGTGAATCAGGGAGGGAATCTTGAATCGACTGAGCACTAGTTTCCAAAATACTGCTTCTT
ATAACGAAAGTGGCTGAGTGATCTTGGATTGACAAGCACTCACCGTCAGCAAAAATCTGA
GTTTGAGAATGTATGCAGGTATAAAGAAACAAAGGAAGACATATTTTTTACATAGCTAAG
TTTATAACAGTATAACTACTGTATGATTTTCATTTCAGCAAATGTGCTGAATGTGCTTGG
CACTTAATTAAGAGTTGGGAATACAGCGATGCATGTCTCTCATGTATTGACTCATGACTG
GTGCCAAAGCAGTTTAAGGCACATTCCATGCGTCACCACCATCCCACACATCAGATCTAC
ATGTAAGTTTCATTATCAATCCTCAGCAAATTAACAAACTGAGGATTACCAAGATTTTGC
CAAGGTCACATCATTGCTGATTGGTTGGCAGGGATCAAACCCATTGCTGATTGGTTGGCA
GGTCCACTCAACTCTGCTGCCTGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved