Homo_sapiens Locus Mono:288:AC016868.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:288:AC016868.8
Homo_sapiens
Mono:288:AC016868.8
8
SNORD65L3
1001..1073
2073
TCTCTTGCCTCAGCCCCACCAAGTAGCTGGGATTACAGGCGCCCGCCACCACGCCCAGC
TTATTTTTGTATTTTTAGTGGAGACGGGGTCTTCACATGTTGGTCAGGCTTGTCTCGAAC
TCCTGACCTCAGATGATCCACCCGCCTCGGCCTCCGAAAGTGCTGGGATTACAGGCGTAA
ATTACCACGCCCAGCCTTCAGGTAGTTCTTTATAGCAGTGTGAGAATGGACTAATACACC
CCTTCAAAAACATGTAAAACATACACCTATGCTGTGACTCAACAATGAGAAATAAAAACA
TGTTTATGCAAACACTTATATAAGAATGCTTATAGCAGCTTTGTTCTTAATAGTCAAATC
CCGAGTATTAATAGGAGGCTGGAATAAACAAACTGTGGTTTATAAAATTACCTTCATTAA
AAAAGAATGAGCTACTGATACATGAAGCAGCATGGATGCCTCTCAAAACTCTTATGCTAA
CTGAAAGGAACCTCGCACACAAGCGTGCATGCTGTACAACTCCACCTATGAGAAATTCTA
CAACAGGCAAATCTAATCTATGACGGAAAAAATCAGAATAGTCGTTATGTCTGAAAGGGT
AAAGTTAAGAATTGACTTGGGACAGCCAGGTGCAGTGGTGTGCACCAGAGTCCCAGCTAC
TTGGGAGGCTGAGGTGGGAGGATTGCATGAGCCCAGAAGTTTGAGGCTGCAGTGTGCTGT
GATCACACCACTACATTCCAGCTTGTGCAACAGAGCGAGACCCTGTCTCTGAAAAACAAA
CAAACAAACAAATAATTGACTAGGGAGAGCATAAAGAAAATTTCTGAAGTGACGGTGATG
TTTTATCACTTGATATGGGTTTGCATTACATAAAAGAATGCATTTTTCAAAATGTACACT
TAAGATTTGAACATTTCATTGTATCTGAAGTTTACATTAAATGAAATATATATATATATA
CACACATACACATATATACGTGTGTGTGTGTGTTTGTGTGTGTGTGATGAAATCACCCCA
AATAGCTGGAATTACCAGCAGATTGTGTAGTGGTGAACCTACAATTTTCTGAAGAAAAAG
AAATATACTCAAAAATAAATATTGAACTCAATAATACGCATGTTTACATATGCACTGATG
TCTTATTTTACTTTGAAATGGATGGATAATGGAAAAATGCATATTGAAACACATGTAGCA
AACTGCTTATGGTGAAATCTTGGCAGTGGGTTTATGAGTTTTCATTGTAAAATTCTTTAA
CTTTTCTACATACTTAGAATTTTTCATAAGATATTGAGAAAAACCTTGAAAAACAAAAAT
ACAAGAAAATGGGACTTTGAGGTAATAGAAATTTTCTTAAGACAAAAATGCACAGAAGAT
ACATTTTACCACATTAACACAAAGAAACATTGGTCAGCAAAAGACATCGTGAAGAAAGGG
AAGAGTGAAAATAAGCACCTGTAATCCCAGCACTTTGGGAGGCCAAGGCGGGCAGATCAC
CTGTGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGCGAAACACTGTCTCTACTAAAA
ATACAAAAATTAGCCAGGCGTGGTGGCACACACCTGTAATCCCAGCTTTCAGGAGGCTGA
GGCAGGAGAATCGCTGAAACCCGGGAAGCAGAGGTTGAAGTGAGCCAACATCGCACCACT
GCACTCCAGCCTGGGTGACACAGCAAGACTCCGTCTCTAAATAAATAAATAAGTAAATAA
ATAAATAAATAAATCTGAATGATCCATGTGGGTCCAATGATACCATCACATGTCCTTATA
AGAGGGAGTCAAGGGAAACAACTACCGAAGTGGAGACGGTGCTGCGATGTTGCCAGCAGG
TGCTGGATGATCACTGTCAAGGACTCCAGGCAGCATTAACAGCTGAAGGGAACCGACGGT
CCCCTCAGAGCATCCAAAAGGGGTCATTCCTGCCAAAATCTTGCCCTTCACACAGGAAAA
CTGCTGTCCCAACTTCTGACTTCCAGAGCTTAAGGGAATACATTTGCATTGCTTTCAGCC
ACGAAGTTTGTGGCGATTTGTCACAGCAGCAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved