Homo_sapiens Locus Mono:101:AL512658.12
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:101:AL512658.12
Homo_sapiens
Mono:101:AL512658.12
6
SNORD28L1
1001..1075
2075
AAGTATCTAAGTTCATCGAAATGAGATTAATTTATTTTCCAGGTACTATATTCCAAGAA
GACTCTATTGCTGGTGTGTTTATATAAAAAGTGATAGACAAGGAAAGTCTTCATCTCTAA
TGTTGGTCCCACTCCACACCTTTCATTTCTCCTTCAGCCCGAACTCCGCATCAAGGCCCC
TCACAAAGGTTGCCGTCACCTGGTATTTACCTATCCCATTCTGCAGATTCTCCAGAAAAG
AGTTACAGGTTAAAGAAGCCTCCAGCTTCTTCTGCCATCTCTCTGGAGGGTGAAATATGG
GACTTAAGGTACCTTCCCCTTAGGAGAAGCAATGGATCTGGATTCTGAAACAGGTCATTA
CCTGGGGTGGAGAGGTGAGGGGCTGAAGCTTCAAGCTGGCTCTGGTCTAGGCTCTGACAA
TCGAGGTGTCTGGATCACCCAGAGAGATTCAATATGAGAGGAAAACAGTCTTGGATTTAG
GCCTGTTCTCTTTCTTGCATTGTATCTCTCAGTAACTTAATGCTGCTAGGTTGCAGGAGC
TGTACGCTTTTGCTAAAGAGTCACATGAATATGAATGCTAAGTCACACCACACCAAAAAA
AAGTTACAAGAAAAACCTTAAGTGATCACCATCACAACACTTATAAGGAATTCTACAGGT
GTCTTTCATTAACTAACCCATCTCAGGGGCTTACTATCATATCACTCCAATTTGGAAATA
TTTGGAAAACTGAGACAATAAAATGTGTATTTGTTAACTTGTGTGTTTTTTCTTCTCAAC
ATCTACTCAAGGCAGGGAAAGATTTTAGAGACACTAGAAGAATAAATGAGCAAAATATTC
TTTGAATTGTCCCCTTCAAATTAAAACTAAATTAAAATTAAAACAAATTAAAATTAAAAC
TCTGTTGACCTTTTGGCAAATTCTTAATTGTTTTTAGAGTTGACAACCCTGACAAGGGCT
TCTGTATCAAGAAGTCACAGAGTCAATTAAAGAGGAATCTCTTCAGATGATTTGAATTGA
TAAGCTGAGGTTCTGTGAGGAATGACAGTTAAGAGCATGTTAAAGTTGTTATGAAAAAAG
AGAAGAATCTCTGAGTCTTCGTTCGATGCCAGATGCAGAACTGAAGACCTTCTGAGGAAA
CAAAGGAGCCTGGTTCTCACCTTGATGAAATGCCAGCACAGAAGCACACCCAGTGTGATC
CCCTGATGGCCAGGAGCAGTTCTCAACTCCAACACTCTTGAAATTTGGGGCCAGATAATT
CTTAGGCTGGGGGAGGGGGCACTGACTGTCTTGTGCATAGTAGGATGTGGGATGTTTGGC
ACCTTACTACACGCCCACTATGTGTCAGTAGTACTCTACCCAGTTGTGAAAAGTAAAAAT
GTCAATGTCCCCTGGAGGTAGGGAGAACAACAACCCCAGTTGAGAACCACTGGCCCAAAG
CTAGGGCCAAAGCCTTTTATAAAAACTGGATTTGAAATCTGCTCAAGTACTCTGACAGAT
TTTGGATTGCAATCCCCAGATTTCTGAGCCAAAGAAGGAAAGAAAATATTTTGGTCTGAA
ATGTTTAAGGTTAAGGCTTACTGCCTGGGTACCTCAATGATTTTTAAATCCCAATATGAC
CCCAGGATAATTTCAGATTGTCAATGGCTCTAAATTCTGATGAGCCCACCAGGCTGTTAG
CTGCCATAGGTACCCGCAAGAACCACAAAAATAGTCTCTAACATGAATAGAGCTTCACAT
TCTACCCAGAATTTTTACATTTGTCATCTTATTTAAGTCTGCATGAGTTATTCATTTAGA
ATTTCCCAGTTAGGACAAAGTCTAGCTTATCTCTGAGGAATCTTGGCCAGCCACGATAAT
TTTAGCTTTCACATAGTAGATACTTTCTGATGATAATCAGGAAAAGAGCTCATTCGTGTT
TTATGGCCATTCCGGTAGGTGATACTAAGATTATGCCATCAACATGGAAGTGGATGAATA
TCTCCCTAGTTGCTATGACAGGCAGAGAAACATCCAAATTATCTAATTGTCACACGGTTA
CTCAAATACACATTTAATAGAAGAATGGCATTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved