Homo_sapiens Locus Mono:89:AL365219.17
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:89:AL365219.17
Homo_sapiens
Mono:89:AL365219.17
6
SNORD66L2
1001..1076
2076
TTGAATCTGAACTCTCATACGCTATAAGTAACATTAAGCCCCTGAAATTTAAAAATGAG
TTCAAATATTTTTAAGCAGATGGAAATTTACAAAGGAACTCAGAAGCCTTCAAGTAATGT
TTAGGGAAGAACCCTGCTTGCTGTTGCATTTCTTCATTGTATGACACTGGCTTTAAGATT
TATAACCTATTACAGTAATATAATGTACGATGAGATCTAATCTCCAGTAAAATCAAGCAT
ACACAATAATAAGCATAGGAGCTAAATCAAGGAATGGTCACAGCTATTTTTCTGGAAAGA
ACATCTTAAAAAAAAAAAGAATGCCATTGTGATGTCGTTTCAATCATGCAGTGTCAGGAA
GCAACAAGTACAATAATAAGTTTATTGCCATATACTGAACTCCCATGCATGCTCTTTTAT
GAGGACTTCTCATTCATTGAGTTGCATTACCCTGAGAAATAAGGATTTTTATTCCCATTT
TAAGAATGAGGAAACAAAAAATATTAGTGAAGTTAAATAACATGCTCAAGTTCATCCAGC
TTGTGGATTGCTAAATTGGGGTCAAAATAAGGAATAAAGGGATCAAATGTACAGTGATAC
TTCAATGAGAAACAGCTTTCTTGAGAATAAAATTAAAATTATTTCATGTCTTACTTTACA
TTCATTTCATTTATTTATTCATTTTTACCATTCATTCTCTTATTCGTCCAACAGATGCCC
CGAGTGCCAACTGTGCCTTTCACTTGCACTTGACTGAAAACACCCAGAAGACAGAAAGGC
ACAGTTTTTGCCCCCAAGAACTTAGAGTTTGGTGGGGAATCAAGCATATGAACTATTGGT
AATAAACAGAGGAACACTGCTTATCCTCTGAAATCATAAGTCAAATTCTTCCATATACTA
AGAAAATAAGAAAAATGGGGATACTATTAGGGCATATAAAGAACATTTCTCTTTACTCTC
TTCAGGCTGTGGCTTGATCATTAAGAGCTTGAAGGATCATGGTCCTCTGATGACTTCATG
TTAGTGCCACCTGTCTGGGCCACGGAGAACCCATGATGGAACTGAGAATCTGAGGAAGAG
AAAAAAAAGATAAAAAAAAAAAAAAGGATCATGGACAGGGGCAAAATATTGATGAACTGG
AGAGGGAATTTCTTTATATTTCCTGGCAAGGGTGAGCTCTGAAACTGATGTCATAGACAG
ATCTTAGAGGCCAGCTCCCAGTGGGAGTAAATTATCTTCCCATAAAATTCATCCATATGA
TAACTATTGATATTATCAGAGAGGAGTGTCTTCAATTAACAAAGATGCATACTCTTAACC
ATACCAAAAATACTTTAGGCTAATCAAAGGTAGACATTATGGAGGAAACAAGTCATGTTT
CATGTCATTGATAAAGAACTTTCAAGTATTCTTTTTTAAGAACACTTTGATAGTTGCCTT
GGTGGTGGACTTGGATCTGCATAGCGTCAAGCCCTTCATTCACTGTCATTTCCTACATGG
ATGAGGGGAACTATTTTAGAAAGGCTGGCATTTCCAAGGGTACCTGGTTAACTTTAAGGT
CTGTAAGAGTAGGACCATGCTGTTTTTTGTTATCACTCTATTATCAAAATTTGTCACAGT
CCCAGACCCATGACAGAAATAACATGTACATTGGTTAATGAAGAAGTAATTTAATCAAAT
GCAATGATTCTTTCCCAATTTGTGCTATTAAAAACAACAAATTAATACTCTGTTCTATTT
TAATGATAGAAATCTTTTTAGGCAGGTGAGAATCTGATAATGTTTATAGTTAAAAAATGT
CATTAATAAATCAATGGGTTCTGAAACCAATTCCCCCTGAAATACTTCTATTGCTATACA
TAATGTAAATATTTATTATAATCCAATATGAAATAAACTCCTTAAAATTTCCCCATTTCT
TTGGAGAATTGGACCTGGACTTATTTTGAGAATAATTAAAAGTGAGGTTTCACCTTGGTT
TATGTCAAATCATTACACCAGAAAATAGCTAAGAACATTGTTCTTTATAGAATCATGCCA
CTAGTATTATTATTTATTTTGATTAAAAGGATTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved