Homo_sapiens Locus Mono:16:AL133387.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:16:AL133387.8
Homo_sapiens
Mono:16:AL133387.8
10
SNORD3@L11
1001..1181
2181
CACAATCTTGGCTCACTACAACCTCCGCCTTCTGAGTTCAAGCAATTCTCCTGCCTAAG
CCTCCCAAGTAGCTGGGATTACAGACATGCGCCACCACACCCAGTTAATTTTTGTATTTT
TTAGTGAGATGGGGTTTGGCCATGTTGGCCAGGCTGGTCTTGAAGGCTTGGCCTCAAGTG
ATCCACCCTCCTTGGCCTCCCAAAATGCTGGGATTACAGGCATGAGCCACCATGTCCCAT
CCAGCCCCCTGTTTTTTTTTTTTTTTTGAGATGAAGTTTCACTCTTATTGTCCAGGCTGG
AGTGCAATGGTGTGATCTCGGCTCACCACAACCTCTGCCTCCCAGGTTCAAGCGATTCTC
CTGCCTTAGCCTCCGGAGTAGCAGGGATTACAGGCATGCACCACCACGCCCGGCTAATTT
TGTATTTTTAGTAGAGATGGGGTTTCTCCATGTTGGTCAGGCTGGTCTCAAACTCCTGAC
CTCAGGTGATCTGCCTGCCTTGGCCTCCCAAAGTGCTGGGATTACAGGTATGAGCCACTA
TGCCCAGCCCCCACCTAGCCTTTTTAATTTTAACCATTTCAGCAGATGTGATCATGATTT
ATTTATATTTTAAAATAATATTAATATTAATAATATTTACCACCTATTGGCACTAGAAAT
TTAGCATCCATTGCCTTTAATATTAACAACTCTAGAAAGTAGATATTTTTATCTCCATTT
TACAAGCGAGGCTCTGGGTGACTAATAGTTGAACAAGGTGACATGGATGTAAGTCATAGA
ACCAGAACACCAATGCAGAATCCTCTGACAACAAAAGCCTGTTTGCCCCTTGCCTGCCAC
ACAGTAGGGAGCAAGAGCCTTGTCTTTCTCCTCTGAGATGCTCCACAGTGCTTAAGTAAG
AGCTTAAGAAGGCTTGTTATATTAAATGAATTGGTGTCCATGAAGAGGCTGTGCTCTTGC
ATCAGGGCAGGCCCATCCAGGTGCTCTAAATTCCAGCGACTAAGACTGTACTTTCAGGGA
TCATTTCTTTAGTTCATTACTAGATAAGTTTCTCTGAATATGTAGAGCGCTGAATTATAA
TAAATAGATTTTAAAATAAATAAGTAAATAAATTCCAGTCACTGACTAGATTTAGTTGCA
ATCAGGAGATCTTGTTTTTGGAAAGAAGGAAGGAAAGAAGGAGGGAAGAGACGAAAGAAG
GAAAGAAAGGAGGGAAGGAAGGAAGGAAAGAAGGAAGGAAGGAAAGAAGGAAGGAAGGAA
GGAAGGAAACACCACTGTTTGTTTGTCTGTTTGTTTGTTTTGAGATGGAGTCTTGCTCTG
TCGCCCAGGCTGGAGTGCAGTAGCTCAATCTCAGCTCACTGCAACCTCCACCTCCCAGGT
TCAAGCCATTCTCTTGCCTTAGCCTCCTGAGTAGCTGGGATTACAGCCACCCGCCACCAT
ACCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGTTTTCGCCATGTTAGCCACGCTGGC
CTTGAACTCTTGAGTTCAGGTGACCTGCCCACGTCGGCCTCCCAGAGTGCTGGGATTACA
GGCGTGAGCCACTGCACCCAGCCAAAACGCCGCTATTAATCAATTGGGCCTCAGTTTCCT
CTTGTGTAAAATGGAGATAATAATATTGCCCTGGCTAATGAGAGAATGAGAGGCAGTGCT
TTACCGTTTGTAAATTTTAATTTGTAAATTGATAGAATTATTTAACCATAGCCACCATCT
GTGGAACTTTCTAAAATATATGGATTCCAGGGACCCAGCCCTGAAGATCCAGATTGGCAT
GATCTAGGGTGGGGCCTGGGTATGTACATTTTTAAAAAGCTTCTCTGGGTGATTTCAATG
CTCAGCTAATGGTGAGAACAGCTGGGGTAAAAATGTGTATGATCATCATTATTGTTTCAG
TATGATCATCACTGTAGTTATCTTTTGGAGGATGAAAGTGGGGAAACACCCTTTAGAGAA
GTCTATAAACACCTAGATCCATTGTAAGTCCTTAAATAAGGACCACTGTCACTGTCTTCG
CTCCCTGGTCATCTCTGGCCTGGGGTTTCAGAGGCAGGTTCATAAGTGTGTGTGTATGTG
TTTTCATGAATATGTGCTTGGAAAAGGCAATGAGAAGAAAGCAGATTATGAGGGGTTTCT
GTCTTGAGAGGAAGCTACTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved