Homo_sapiens Locus Mono:109:AC079880.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:109:AC079880.6
Homo_sapiens
Mono:109:AC079880.6
4
SNORA62L2
1001..1151
2151
AAATAAGCAAATGTAAAATATTAATATTTGAGAAAATCTGGGTGAAGGTATCCAGAAAT
ATGTATGATTCTTGTAACCATTCTCTGAGTGTCAAATTATTTTTAAAAAGCCTTTATCCT
ACAACTTTTAAAAACACAAACTGAATCAACAATTAAGAAAATGTTGCAAGTAATTTTCAA
AAATAAATTCTAGTGGACATTTATTCATTATTCCTCTATTCATTAAACACTTCTTACCTA
CTTATTTATAAGCTTTTCCCCTGAGAAGTTTCATTTTACTGTGAAACATTATTAAAATGA
AATGATGAGAGTTTAAGCATTTTTAAATTGATAGCAAGTAAATTCAAACAAAAGTGTTAC
AATATTTTTTATTTTAAGCAAATGAGGGATTCCATTTTTTTAAAGTTTTTGATTGAATTA
GAAAATTTTAATTACAATATTAAGAAACATGATTCTTTTCTACCCTACCAACAAAAAACA
CTATTAAATATTTTAAAAATACTTCATTTTTTTTTAAAAGGCATACTCCACTCCCACTCC
CATCACCTCAAAAGGGAAAGAAACCTTGGCCCTGTTAAATAAGTTAAAAAGTTGATTTTC
AGTTTCAGAGCTTTTTTCATTTTCAAGGGGAAAAAATGATTTTAAATTCATCCACTAGAG
GGCGTCTAATAATTTTACTATCACTCCAGTCAAGAAACCCCAACAAGTGCATTCAGCTAA
TTTTATCTTATGATTCAGACTTTTTTCCCACATTACAAAGTGAGACTTTTAGTTTTCTGT
AATTCTTTGCAACCTGACCTTATTTAAAGTTCAGCTTTGAATTAGATCCAACAGAGGCTG
TGAGTTAAAGTCTTTGGAAGGCTTACTTCACGTAGAACCTGAGAATCTTATATTTCTTTA
AGGTTTTAGCTACTTCCCTCTGCACCATCCCAGCTGGACTTGGAACCATATGACCTGAGT
TTTACTTTCTGCTCTGCCCTGGGCCACATTTTCGTCTTAATATTTCATGTTTTAAAGGCA
TAATGATGTCACTGACTGGCTGATGAAATCCCAAGCGTAGGTAGTATGCTACATGAGGGG
TGAGTTTTTTGCTAACACCACAAAGGTCTCTGGCCCAATGAGTGGAGTTTGATAGGAGTT
CTTGTGACAAGTCTAATGTTATTGCATGCCAGTTTTGAGGAGAGATGAAAACATTTGAAA
AGCAGTGTGTTTTTTTTCTACGTTTGTCTGTATTTCTTACTCAGGCCTCTCAGGCATTAC
TTGGCCTTTCTGTTTTCACACCAACTTGGTGAGTTCTACTATAAGATTCTAAAAAGATGG
GTAGTGCGTGGTTCAAATTGGTTCATTTGTAACTGGAAAAAATTTATAATTAAAAAAATA
AAATATGTTTAAAAAAGCCATAATGATGAAACTTTCAATTAGCAATGACTTTGAAACATA
GTACTATGATTGAGTTAATGGCTATCTTATTTAACACATGCTTATTTTTTAAGCAACTCT
TTGGTAAAATAAACTATAGCTGGCATTCTCTGTCATAAAAGATAAAGCAGTTATATCCTT
CAATCAGGGAATTTAATATTTGGTAGTGCAGATTTAAAATGTATGTGACCCAGGTAATAC
AAGATAGACCAATAAATTTTAAGAAAGGTATAATAAAGTGTACACAAATTCAGAATCTTA
CTTGCCCATAAATTAACTTGCTATTGTCTTAGTTCCGTTTATTTTGTGCTCCAAGGCCAT
GTTCATTTGAATGATTTATGTAGAGATCCACTTTGCTTTTAGTTGTTCATTTGTCCTTGG
ATTATATTTCTTTAATTTTGGTATATTTCTCCTCTCTTGCCCCTGGCCCTGGTTCTTATC
AGTGTTTGCTTTATTTTGCCATAAACAAGAACATTCTGTTTTTGTTTTTCACAGTCAATT
GCAGTTGTTCATTTCTTCTTAGAATATTATCTTTAACACTCACCTTACCCACACTAATTA
CACCCTTACCTAGTGTTGTCCACAGGTAATTATCTTCAGATGTGTGCTTCAGTTTCCTCA
TCTACATACATGGAGAAAATAGTAATATCTACCTCTAAGGCCTATCATGACAATAAATGA
GTTAATACATGCAAAGCACCTGGAATAGTGCCTGGAACACAGCACTTTATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved