Homo_sapiens Locus Mono:21:AL031650.22
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:21:AL031650.22
Homo_sapiens
Mono:21:AL031650.22
20
SNORA40L3
1001..1128
2128
TTGGTATTTTTAGTAGAAACAGGGTTTCATCATGTTGGTCAGGCTGGTCTCGAACTCCT
GACCTCGTGATCCACCCGCCTTGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACC
GCACCCAGACGGTTTTGATATTCTTGGCCTTACTTTCTTGCAAGGTTAAAGATGCTTTAA
AAGTTTTGTTGTATATTTTAAGTAAGTTTTTTTCACTGTTTTCAGTGGGAGGATCAGCCT
GGGTTCCTCAACCAGTATTCTTCCTGAAACAGAGGTCCAGAACCAACACTTTTGTCCAGA
TCATAAACCTTGTTGTTGGGATGGGTGGCAGCACCAGAGGAAGGAGAAAAAAAGATCATT
GTCAAAGGATGAAACTATCACTCAGTGTCTAAAACCAAAATGCTGAAATGATTGCTTTCT
TAAGAACAGGAAAGCCATGCTGGTCCATCATAAGCTCCTTCACCAGAGTGAAGTGTTGAA
CTTACACAGCATTTGGGGAACACATTTTGAGGGAGTTGTGTTGGTTACAGAGGTGGGAAT
TGGTTAATGACAATTTAGAAGTGTGTACACTGAAATGAATTCAAAGCTGATTGGCATAAT
CAAAGCATAAGGCTGTCACTGACAATGAGCTTTCAGAAGTGTGTTCACTGAAGCAAGTTG
TCGTTGATCAATGAAAAAAGTTTAAAACAGTTCAAGGTATGTACTTATTATCACGACCAT
AGGACTGTCAGCCTTTTCCTAGGAATGTGGAGAGTTTTTATTCTCAGAAGAGAAGAGTAA
CCCCAGAAGAATCCAATGAGACAAATAACAGAAGAGGAACCCCAAAAGATGATGTAGAAG
GGGGAGCCTGAAAGTTAGGAAGAAAACAAAGAGTGAAATCACAGAACCCTAGGCAGTTAA
GGTTTTCAAGGGGGGAATAACCTATAGTGGAAATGCTGCCTAGAGGCAGATTGAGATACA
AGTTGAGGAACATTCTGAAACTTTCAAAACGGAGGTCCAGCTACACTTGTTTATATTTTT
GTTTAACTTGTGGACAAAGATTTATAGACAGGTGCAAAAAATAAATCCTCTTTTGCAACC
CAGAACTCATTGTTCGGTATGAGTTTTAATACATATAAGAAGGGATATTATGATGAAAAA
AAAAAAAAGGAGGTCCACTGGTGACCTTGGCCAGAGCCAGTTCAATAGCAAATAAGCACA
AAGGCAAACTGTAATGAGTTGAGGAGAATCAGAGAAGAAGAGAAAGATAATGGGTTAAAT
ACTACTCTACTTTTGACAGAATTTAGAACTGCTAGTGGGAGGTAAGACACAAAAAGTAAA
ATTAGAATTTTATATTAAAAAGCTGGTGTTAGTTGTCATTGGGGGCATAAGCCTCTTAGG
TTTTGAAGAATTGGAGGACCTTAACTATCAACAACAACAGCATCCAATATTCAAAGACCT
TCTGCAATAACCACCAAACAGGCCCTTCAGCCTCACAGCTTGAAACCAACACAGCTTATT
CCACATTACAGCAGCTCTGTTGGTTATAACGTTTTTTCATGAACTAGGCCAAAGTTGTCT
ACAAGATCTCTACCTACTGCCCTATGTATCCATCCCACTGGTTAAAGATCCTCCCTGAGT
TCTACATGGCACAGATTAAGTCATAAATCTGCCTAAAGCCTTCGACCCTCCCTCATTCGA
TTCATTCTTCCCCCTTCCTCACCGGCTTGTCTAGCTTCTCTGTAATTGTTTCCCCAGTTT
TCCAGCCTTCTTTCTCATGGGGCTCACCCAGAATGAGACAGACATTGTCACCATGCAAAG
CCCAGTCTCTCACTATGATTTCCAGTGGACCAAAGACAGACAAGGGTAGCAGGCACATGA
ATTTTAATGAGGGGGGTTGACAGCAGGTCTCTGTGCCCAGAGAGCTTGAGAATGGTAATC
ACCAGCACTCAAGGTAGTCTTGGCCACTGCTTCTCATAAGACCAGTCGGTATTTTCCTCT
TTGCCAGAAATGCTTATCCTCATGTAGGACTGGAGGCAGCAGGACTGACAATTTCTGCAA
TAGAGGTAGGGCTGTTCGTTCTTTTTGCAAGAGGCCCTACAAATTCCACTGTTACCCATG
CATCGAAGGATGTGGCGTTTGCCTGCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved