Homo_sapiens Locus Mono:198:AC141001.6
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:198:AC141001.6
Homo_sapiens
Mono:198:AC141001.6
X
SNORA48L4
1001..1135
2135
AGACACACAGCCAAGGAGATGCAGCATAGAGTAAATTATTGCAAAACAAAAAGAGTATT
TTGAAAGTCAGCGGGAGACTAGAGAGTACAACCTGAGAAAGTAGATTCAGGGCAGGCAGC
TAGTTAGGGTGACAGAGTATTGATTATTGCTGGAGAAACTCCCTTTATGGGAGTCTTACA
TGATGATTTATAAGGAGGTGGAAAGAGGTGTTGCTGTTAAGCATGTTCTGGGTGGTCCTC
TGGGTGCACATGAGCAGTAGCTGTACGTGCTTTTTCATGCATTGCAGGTCTCATTAACAT
CTTATATCTCTACCCGCAGGTGTGCTTTTTACTATTAAAATGAGCAAAGGGTCAGTTTGA
GGACTGGTAACATCAAAATGCGCATGCTCTCTGTAAGGGAAAGTTCCTACTGAAGAATTG
TTTTGCTTGAATGAGTTCAATGACAGTGCAAATGCTGAAGCTTACTGTGTTGACTGTATG
GTCATGGTAACCATGGTTGCTGCACACAAAGAACACAGTCATTTTCTTGACTACCTATCC
TGCCTCAGCAATGCTGAAAAGAAATACCTGAGACTAGATAATTATGAAGAAAAGAGGTTG
AATTGGCTCACAGTTCTGCAGGCTGTACAGGAAACATGGCAGCTTCTGCTTCTGGGGAGG
CCTCAGGAACTGACAATCATGGTGGAAGGTGAAGGGGGAGCAGGCATCTTAGTGACTGGA
GTAGGAAGAAGAGAGAGAAAGGCGTGGGGAGGTGCTACACACTTCTGAACAAGCAAAAGA
TTTCGTGATCACTCACTCACTATGATGAGAACAGCACTGAGCAGAAGGTGTTAAACCATT
CTTGAAGGACCCACCCCTATGATCCAATCACCTCTCTCCAGACCCCACCTCCAAAACTGG
GGAATACAATTTGACATGAGATTTGGTGGGAACACAGATCCAAACCCTATCGCTGACTGT
CTTTGAGTGCCTTTCTGATTTGTCCTAAGAAGCTCATTTTATTTCCCTGACCTGGGTAGA
GTGGCATCCAGTTGGTGGTGCCCATCTCATATCAGCCAGGGACAAAGCAACCCCTTGTTC
CTCCCAGCTTGGCTTTTCATCTGTGCCTATGCCTGGTTCATGCCTTGGACACATTTTTTT
TTTAAAAAATGTAAAGCTAATTTTAAGGGATAACAGCATGGCAGAAAAAGGGGTAAATAA
ATGGAGAATTGGACCACCTATGTAGAATAACCAAGGTAGACCTGGGTAAAAAATTAGAGT
TTGCATAAGACAATCAATCATGAAGCCACACACACACACACATGTCCCCCACAAGTGAGG
ATGACACATGAAAAAGTGACTTTTCCAAATCCTTGGGGAAAAATATGATTCAGAATCCCT
CTTCAGAAGTCACTGGTTTTTATTGTGGAGTTGTGAAAGGTCAGTCTGTGCTCTGGAAAA
TCCTGATGTGAGTGGGACTTGTGTTCAGTTTCCCGTTAACCCTTTTTGGGAGTCTGCCTT
CTCCTTTAGCAGATTAAGTCTTGTTAATTCCAGGCTCTCTGCTGCAGTAGGGGGTTTGTC
TTTCTTGGAAGTAAATCAGCTGGGTTTTCGAACCTGACAATCCATTTGCTGACAGTGCAC
TATTTATTAATTCTTACTCAAGTGTCAATGGCTACTTAATTATGGCAACAGGCAAACAGC
ACTGGCATTTTACCAGACCTAATGTCATAATAGTAGAACACCTACTGAGTGGGAATTTTC
ATTACACCCAGAAGAGCAAGGGGATGCTATTTTATCTACGAGTTGGCTGTGAGGAGAAAC
TGTCTGATTTGCTCTTTTGCAAACAGCATTTGTATCTACTCTCTCCCTTTTTTTCCCACT
CCAAATTATTCTCTCCTGGTTTCCCACTCTCTGTCAAATTATCTGATATTAACACCCTTT
CCTCCCCTCCCCTGTCCTCCCCTCCCCTCCTCTCCTCTCCTCTTTTCCTTTCCTTTCGAC
AGGATTTTCCTCTGTAACCGAGGCTGGAGTGCAGTGACACATTCATAGCTCACTGCAGCC
TCCAACTCCTGGATATATATATTACATATATGACAGTCATTCCTTAAAGATATAATGAAT
CTGCCCTATACTAATGTACCATTTTTTATTTTATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved