Homo_sapiens Locus Mono:226:AL358875.13
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:226:AL358875.13
Homo_sapiens
Mono:226:AL358875.13
1
SNORD3@L19
1001..1203
2203
AAAAAGGAAATTCTACCATATATGACAACATGAATGAACCTTAAGGACATTATGCTAAG
CAAAATCAGCCAGTCACAGTATTACCAGCACCACACTCTGGGTTCTTGAAATCTCCCAGA
TAGAAATCAAGGGAGATCACCAGACATAGCAGCAGACAGAAAGTGAAAGTGTATTAAGGT
TGTGCACAGGGGAGTCAGTACCACCAAAGGAAAAGGGTGGGCTGCTCCTCAAGAGAAGTA
TGGGAAAGAGTTTCATCAGTTATGTCCAGGAGGGGTTTCTCTAGCACTTGAACAGTGGCT
TTACATGCTTCTTCATACCTAGCACATTACATTATCATTTTAAATCTCCACCCCTGGGCA
TAATTTTTAGCATTGAAATGAGGTCACTGTAAGGTGAAGTTTAAGTCTAACTGTGCAGGA
AAGGCCCTGGGGAACTTGGCCAGGCAATTCCTCTGCCCATGACAGGAACTTGTGGTAAAT
AGTGCCTTGGTTCTTTTGCTGCTGATTGGCTTGAAGTTAGGTAAGCTATAGCTTGAGTAC
AGGGCTTTTGTTCTTTTTCTCTAAACTACATTAAATTAGGAAACCAGCCTGCCTGCCTGT
CTCAACAGAAGAACAAACACTGCATGATTCCTTTTATATCAAATATCTAAAATAGTTAAG
CTCACAGAAACTTAGAGCAGAATGGTGATTGTTGGAGAATGGATGGAGGGGCATATACGG
CATTCAATGGTTATGAACTTTTAGTTATAAAATATGAATAAGTTATATAGATCTTCTGTA
CAACATTGTGCCTATAGTTAACTGTATTATGCATATCAAGTGTTCTTACTACAATAATAA
TAACAAAAATAAAGCACCATTATGAGCCAAGAGGCAAACTACCTGTTAGAAGAAGATATT
TGTAATAAATATAGTCAACATAGGACTCATGACCTGTATATATAAGTAATTACTACGTAT
TAATAGAATAAATGCAGAAGAATTCCAATAGTGTATATCCAAAGACTATTCTTTCAGGGA
TCATTATGCGAGAAGTTTTTCTGAATGCCTAAAGAACCAGAAAACCATGAGGACAGACAG
CAGCATTTTCTCCTGAGCTTGAAGCTGGCTCTTGGCACTGGTTTGCTGCAACTGCCGTTT
GCCATTGCTGATCATTTTTCTCTTCCTTTGGGAGAGTGAGGGGAAGAGAATGCAATCTGA
GTGATATTTCTTAAAAGAGGAAAAAAAGACCAATAATATATGAAAAGGTGCTCAATTCTA
TTAGACATCAATTAAAATCACAATAACTTAAATACACACCCACCAGAATTGCTTACCTGA
AGAAACCAAACCACAACAAAACAAAACAAAGAAATCATCTGACAATACTAAAGTTGGTGG
GAATGTGAAGCCATTAGACATTTTATACACCACCAGCAAGGGTAAAAACTTTTACCCTTA
GATTGGTAGTATCTAATAAAGCTAAACAGACAAATGGCAACAATCCAGTTGATGTGGTTA
AGCTTTGTGTCCCCACCCAACTCTCATCTTGAATTGTAATCCCCATAATCCCCACACGTC
AAGGGAGAGACCAGATGGAGCAGGTGGAGGTAATTGAATCATGAGGGCAGTTTCCCCCAT
GCTGTTCGCATGATAGTCAGTTCTCACAAGATCTGATGATTATGTAAGGGGCTCTTCCCC
CTTCTCTCAGCACTTCTCCTTCCTGCTGCCTTGTGAAGAAGGTGCCTTGCTCCCCTTCAC
CTTCCGCCATGATTGTAAGTTTCCTGAGGCCTCCGCAGCCATGCTGAACTGTGAGTCAAT
TAAACCTCTTTCCTTTATAAATTACCCAGCCTCAGGCAGTTCTTTATAGCAGTGTGCAAA
TGGACTAATACACCAGTAAATTCACTTCAAGGTACATGCCAAATAAAATTGTGTATTTAT
GTTCACCCAAAAGACACATCGAAAAATGTAGCCCAAACCCCAATCTATAATAGAAAAAAT
AAATTAATAGTGGTAAATTTTGGCAATGCAACATTATACAGTAATGAGAGAATGAACAAA
ATACTGCTGCAGATGAGAAGAATGAACCTCACAAGCATAAACTGGAGCAAAAGAAGCCAA
ACATAATGAGTGAGATACTATATGTTCCACTTACACAAACGTCAAAATCAGGTAAAAGTA
AGTAAAAGATAGCTGTCCCAAGATAGGTACTGGGAGAATGCGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved