Homo_sapiens Locus Mono:123:AC024589.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:123:AC024589.5
Homo_sapiens
Mono:123:AC024589.5
5
SNORA18L1
1001..1115
2115
CTGCAGGGGCAGAAACCTCATGAAGAATATAAGGTTATTTTTATTTATCTTTTTATGTG
ATCCATATTTTTTCTCTCTCTCTCTCTCTGTCTGTACTTTCCTCCTTCATTCTCTCAAAT
TGCAGGTTATTCTTTTTCTCTCCAGTGTGCTAAACTTTCTTTACTTCCTGCCCTAGAAAA
AGTCTATATTCTTGCCCAGGTTTAGGGCCTCAGTGGACCCTGAATTAGGAAATGTTCTTT
AGTCCTGACCTATTTTCATGATCTCATTAAGGGTTTTCTACACTGTTTTCTTTTTGGAAA
CAATGTATAGGTTTATGCGTAATCTGTTCATAGGAATGGTGCATTAAGGAGGGGCCTCAC
TGACAGTCTCTTCAGTATTTCATTTTGGGCTGGTCAGTTTCTCTGGGAACTATTCCCGAA
AGGTCTTTGTTTGATAGTAGAGGACAGGGTGAAAATAAAGATGGGCATTGGCTTTCAGTT
TGCATGCATAATGAAGATTTCTGCTTTTGGCCTGTTACCTCTGCCTACAAAAGTGTCTGA
ATTCCCCTCATTAATAAGTCCTATTCTTTATCATCTCCAGAGAACAAATTGGCATTCTTC
TCTCTGTTTGAGGGACTGTTAGACATGTGGCTGAATGCAGTGGAGGAAGAAACTCAGGAT
GCTGCTCATTCTTGAATAGGTTTTAAGTGACTATCCTAATTTTGTGACCCCTGGGTTATC
ACTACTTTCAGAGGTATCAGACGCTTTTAATTCATGAATCTTGTAAGTATTCTGTATTAT
AAATATATACACTTGATTATTAATCTTCCCCACTGCCAATTTAGAATTTCCATTTTATAG
CTTATTTCACTACTAATTTATTTACTTTTCATTGTTCAACATTTCATTATTTTTTAAACA
ATCATTCCTTGAAGATAAGAAATTTGTCTTAAAGATCAACATTTATTTTACTCTCAAAAG
CAACTCTAGTTTTGTGATACGTTAAGATTATACAGTTTGTGGAGGAGGTCCATTTTAAAA
AAGAATAGATTGGAAATGCCTCATAGAGTAACTCTGTGGTTTTATTTTACCCACAGGACT
ATGGTTAAATATGTGGGAAAGAACTACAAGACAGTTGTTAAAAGTATGAAAAAGACAGTT
GCTAAATGTATGAAAGACCTTTTTTACCTTAAGTATTGGCATATTCCACACGTCTGTACT
ATTCTTGAGTGAGCTCGCTTAAGAATGAATATGACTTGAACTCATTCATGTTTAGAGAGG
ATGTCAAATTGAGAACCAGGTGTATCTACCAACACTAAAAATGACCCTAAAGTAAATTGG
TTGAAGAAATTAGATCTCAAAGATTCTTGGTGAATTTTTAAGTCTTCATCCGTATATCCA
TATTCAAAGGAGATGACAGAAGCCAAAATAAAAGAATTATGGGCTGACAGGACAACTGGA
ATAAAATAAGTATCAGTTTCATTAAAAAGGGCTAACTTGAAGATAAATCTTTTGAAGATA
AATTTTAACTCCAGCTCTTTAGAGGATCTAAAGTGACCTTAATGGACAGTGGAAGAATCA
CAACATAGAATTCCTCGAATAAAAATTTATTGACTTTAAATAAAAATAAATAAATAAATA
AATAAAATAGAAATAAAATAGGAAATTTCATACAGAATCTTGAAAGCAGTTCATGCAATT
TATATGCCCTAAAGTTTAAGATTAACTAGCTTCATGATAAATGTATTTCTGATTCTAGTG
TCAATTGTTTGGGGAGGACGATGAATTAGATGCTTATTTTCAGCTTGCCCTCATTATTCA
GAAGTCTGATTTGAATCACTTTGTAAGTGTGCTCACTCAAAAATATCATGTTTTGAAACC
GTTCATTTTTTGTATTTTTTTTGGTTATTGGATATTAACATATAACTAGAATATAATTTT
AATGGCCTTAGGCCTTTACATAACACCTAAAATAAATTTAGCCTCATTTCCTCTATCATA
TATGCAAACTACTTTCAGCATGGTAAAACTTATTGTCTCACAGAATACAAGTAAGTATCA
AGCCCATACAATTACACAAATATACATAATATACGAGTGTATAAATGCCAAAGAGAAAAA
AAAATATGAAAATGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved