Homo_sapiens Locus Mono:103:AC092535.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:103:AC092535.4
Homo_sapiens
Mono:103:AC092535.4
4
SNORA48L2
1001..1130
2130
GCTATGCAAGCAAGAAGAGAGTAGAGTGAAATATTTAATGTATTGGGAATAAAAAAATG
ACCAACCTAGACTTTGGTATCCTGCAAAATTATCCTGCAAGAGATAAGGGAATAAAGCCT
TTCTCAAACAAGTAAAAACTGAAGGAATTTTTTGGTGGTAGATCTGCCTTGTAAGAAGTG
TTAAAAGAAGTTCTTCAGAAAGAAGGAAAATGATGTAGGTCAGAAACTCAAATCTGCATA
AAGGATGAGCATTAGAAAAGTGGAGGTAAAATTAAAACTTTCTATTTTCTTATTCTTAAC
TGACCTAAGAAATATCACTTTATTCAAGATAATAGCAACAATGTATCGAATGGTCATATT
TTACCTGTAAGTGAAATTAATGAAAGCCATGATAAAATCAGGGGCAGCAGGGAAGAATTA
GGAATATTTTGTTAATAAAAGGCACTTGCGGCTGGGCATGGTGGCTCACACCTATAATCC
CAGCACTTTGAGAGGCTGAGGCGGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCT
GGCCAGCATGGTGAAACCCTGTCTCTACTAACAAATGCAAAAAATAATTAGCCAGGCGTG
GTGGTGGGTGCCTGTAATTCCAGCTACTCAGAAGGCTGAGGCAGGGAGAATTGCTTGAAC
CTGGGAGGCAGAGGTTATAGTGAGCTGAGTTCACGGCAGCCTGGGTGACAGAGTAAGACT
CCGTCTCAAAAAAAAAAAAAAGGCACTTCCTGTGAAGTGGTAGTGTATAGTGTTATTTGA
AATTCGACTTGGACTAGTTGTGAATGTATATGGCAAACTCTAGGGAAACTTCATATGCTA
ACAGAGAGCACGGAATCACAGAAAATGCTCAATTAAAACCACAAAAGGCATGAAAAAGAG
GAGAAGAAAAAAATAATGAGGGCAATGAATAGAAAATGGTAACAAATATGGCAGATACTA
ATCCAGCTATATAAATCATCACTTTAAATGTTAATGGTCTGTGTCCTTGGCCTGGGTAGA
GTGGCACCTAGTTGGTGGTGCCCATATTAGCCAGGGACAAAGCAACCCTTTGTTCATCCC
AGCTTGGCTTTTGATCTGTACCTATACCTGGTTCATGCCTTAGACACATGGAAAAAAAAT
GTCAATGGTCTAAATACACCAGTTAAAAAATAGAGTGGATCAAAAAAATGAGACCCAATT
ATATGTTGTCTATAAGAAAATCATTTGAAATGTAAAGACACATAGATTAAAAGTGAAGGG
ATAGGGAAAGATACATCATGGTAACCTTAATCAAAAGAAGGCTGGAGTAGCTGTATTAAT
TTCAGGCAAAGTAGACTTCAGAAGCAATGGAAATTATCAGGGATAATTACATAATGGAGC
AATACATAATGATAGGAGGGTGAATTCTCTAAGGAGACAACAATCCTTAACATGTATGCA
CCTGACAATAGAGCATGAAAATATGTGAAGTAAAGCCTGATAGAACTGCAAGGAAAAAAT
AGATGAACACTTTATTATAGTTGGAGTTTTCAGCCCCTTCTGTCAGAAATGGACAGATCC
TGCAGGCCAAAATTAGTAAGGACATCGTTGAACTCAGTGGCACCATCAGTTGACTGGAGA
TAATTGACACCTATGATTACTTTATCCAGTGATAGCAGAGGACACGTTTTTCTCAAGTTC
ACATGGAACATTCGTCAAGATAGACCACATTCTGGGCCATATATCACACCTTAAAGAATT
TAAAATAATAGAAATCATACACTGTATGTTTTCAGGCCTCAATGGAATTAAACTGGAAAT
CAGTAACAGAGAGATAGCTGGAAAATCGCAAAATACTTGGAGATTAAACAACACACTTCT
AATTAACACATGGGTCAAAGAAGAAATCTCAAGACAAAATGAAACTACAACTTACCAAAA
TTTGTGGGATGCAATAAAAGCAGTGACTAGAGGGAAATTGAAAGCATTGAATCCATATAC
AGTTGGCTGTCTATAATGCCAGGTTTCACATCCATGGATTAAACCAGCCATGGATTGAAA
ATATTTGAAAAAAATATATGTGACAGAAATAATACAAGTGAAAAACTACAGCATAACAAC
GATGCAGCATTTACATTGTATTAGATATAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved