Homo_sapiens Locus Mono:85:AL033519.42
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:85:AL033519.42
Homo_sapiens
Mono:85:AL033519.42
6
SNORA40L9
1001..1128
2128
ATGGTTCCCAGTTGTTTGTAGATTTTGGTGGGTGGGTGGGTATGATCATTTTAGAGCAC
TGGATTACAATTATGCAAATATTGTTCATTACATGCCAAAATGTCTTTTTCACTGTTTTC
CCTTTAAGACAGCTAATCTCTGAAAATATCACTAATATGGAGCAGGTGACGTCTTACCCA
TTCCACATAAACAATCTTCTAATACTCACATGAAAAGACAGATGGATTTTCAAGATGTAC
TATTAAGTGAATGGTGAGTTGCAGAATGATTTGTAACATGATCCTATTTCCAAGAGGAAA
AAAGTATATATGTGTTTGTATATTTGCTTATATATAGAAGAAGTTTGGAAAGATAACTTA
CCAAACTGCTCAAACAGTGTTACCTCTGGAGAATGAGATTTGGGAAGATAAGAAGGAATT
TTCACTTCTTAGATTTTATTTTTATATTATTTAAATAGTTTAACATTAAACATGTATTAC
TTTCATGATCTTTTTAAACTTAGGGAAAAAAGATGAAACATTTCATGGTTCCACTCATCA
GGACTTTTTATTCTTTCTCTTCAATTTAATTCGAACATTTCAGATTGCTTTTTATGGAGA
GCAAGAGAACTCTGGCTGGGGTATGTTGAGCAAGGGGTGCTTGTGCGATGTCCAGAAGGT
TATCAGAGATAAGGCCTGAGCTCAGGAGAGAAGTGTGGGTGACAGTTATATGTTGGGGAG
TCATCAGATTCTACACAATAATTAAGATAAAAAGTACTGTTGCAGTTATATACTACTAAG
CAAATAAAACCGTGGCTTTCAAACTTTTAATATCCAAGTCTTACTTCTGATTAGGTTGAG
CATTCCTAATTGGAAAAATCCGAAATCCAAGATGCTCCAAACTCTGAAACTTTTTGAATT
CTAACATGATGCCACAAGTGAAAAACTCCACACCTAATACTTGTTTTCTAATGATTCAAG
GTACACAAATTTTATTTAATGCACAAAATTATTAAAAATACTGTATACTACACTGTTTTT
GTTTAACTTGTGGACAAAGACTTATGGTTAGGTGCAAAAAATAAATCCTCTTTTGCAACC
CAGAACTCATTGTTCAGTATGAGTTTTGATACATATAAGAAGGTGTTGCAGGAAGTCAGG
GACCCCAAACGGAGGAACCGGCTGAAGCCATGACAGAAGAACGTGGATTATGAAGATTTT
ATGGACATTTATTAGTTCCCCAAATTAATATTTTTGTAATTTCTTATGCCTGTCTTTACT
GCACTCTCTAAACATAAATTGTAAAGATTTCATGGACACTTATCACTTCCCCAATCAATA
CCCTTGTGATTTCCTATGCCTGTCTTTACTTTAATCTCTTAATCCTGTCAGCCGAGAAGG
ATGTGTATCGTCTCAGGACCCTGTAATAATTGCGTTAAGTACACAAATTGTACAGCATGT
GTGTTTGAGCAATATGAAATGTGGGCACCCTGAAAAAAGAACAGGATAACAGCAATTGTT
CAGGGAATAAGAGAGATAACCTTAAACTCTGACCGCCGGTGAGCCGGGCAGAACAGAGCC
ATATTTCTCTTCTTTCAAAAGCAAATGGGAGAAATATTACTGAATTCCTTTTCTCAGCAT
GGAAAGTCCCTGAGAAAGAGAATGCGCACCTAGGGGTAGGTCTCTGAACTGGCCCCCCCG
GGGCATACCTGTCTCTTATGGTCGAGATTGCAGAGGTGAAATAAACTCCAGTCTCCCATA
GCGCTCCCAGGCTTATTAGGAAGAGGAAATTCCCGCCTAATAAACTTTGGTCAGACTAGT
TGATCTCAAAACCCTGTCTCCTGATAAGATGTTATCAATGACAATGGTGCCCGAAACTTT
ATTAGCAATTTTAATTTCGCCTCTGTCCTGTGGTCCTGTGATCTCGCCCTGCCTCCACTT
GCTTTGTGATATTCTATTACCCTGTTAAGTACTTGACGTCTGTCACCCACAACTATTCGC
ACACTCCCTCCCCTTTTGAAAATCCCTAATAAAAACTTGCTGGTTTTTGTGGCTTGTGGG
GCATCACGGATCCTACCAATGTGTGATGTCTCCCCCGGACGCCCAGCTTTAAAATTTCTC
TCTTTTGTACTCTGTCCTTTTATTTCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved