Homo_sapiens Locus Mono:24:AC104794.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:24:AC104794.4
Homo_sapiens
Mono:24:AC104794.4
2
SNORA26L10
1001..1115
2115
TGAAGAGCTCCTCAAGCGTGGCCAGAATGGGCTCCGAGAGCGAGCGCGGGCTGCCAGCA
CGCTGTCACCTCTCACTACCTCAGTACCTTCCCTTCTCATTTTTCTTCTGCTTGGAGAAA
CTCCTACTTCCTTCTTTTTTTGAGACAGGGTCTCACGCTGTTGCACAGACTGGAGTGCAG
TGGTGTGATCACAGTTCACTGCAGCCTCCACCCTCTGGGCTCAAGGGATCCTCCCACCTC
AGCCTCCTGAGTAGCTGGGACTACAGGTGTGTACCACCATGCCTGGCTAATTTTTTTTTT
TTTTTTTGTAAAGATAAAGTCTTACTAAGTTGCTTAAGCTGGCCTTGAACTCCTGGGCTC
AAGCAGTCCGCCTGCCTTGGCCTCCCAAAGTGCTGGGATTCCAGGCGTGAGCCACTGTGC
ATGGCCCTTCCTTTGTAGTTTGCACCTGTTATTACATGTTTCTCCAGTTACTTTAACTAT
TCCACTGGCCCCTGAGCATCTTGAGGGTAGGGATTATGGATTATTCATGTCTATATCCCT
AAATGTATCACACGGTAGGTGCTCTACAAACATTTGTAGAGTTGAATCAAATGGAACATG
TGAGGTGTACACTTGTGCAAACAGATTGAGCTTCTTTTCTGATAATTTCATTTTGGTGTA
AGTTTGCTTTCAGTTTAAGTAGTCAAAACATTTGGATAGCTATTCTTTTTTTTTGGATAA
GTATTCTTGAGTGGACTAAAAATAGATTTTAATTGATTTCTAGTGCCGATGCTGCAAAAC
TGGAAATCTAAAAGATTTTATCCTTTTATTAGAGTCTGAAGAAGAAAAAGAACAAGGGAG
TGGAAATGCTTTTAACATTTTATCTGCCCCCTTTCCTGTGCCTTTTTTTTTTTTTTTTTT
TTTGAGATGGAGTCTTTGTCACCCAGGCTGGAGTGCAATGGCGTGATCTCGGATCACTGC
AACCTCCGCCTCCCAGGTTCAAGCGATTCTCCTGCCTTCCTGTGCCTAAGGTTAACACAG
CGCCTTAAGAGGCTAACACAGAAGGGCAAAGTAAGTCTCCATAAAACCCAGAGAAGACTG
TGAACCCCTCTCTGGATCCTGTCTGGAGTCACAGCTGGAAAACAAAAACACATTTATCTG
GTAGGAATAAAGAAATTTAGAAGAAGCAGAAAAGGAAAAATGATTTTCAGATCTAGTTTT
TTGTTCTTCCAAAAGGAGGAATTTAAACATGAGGGAGACTAATTTATTTCCCCTTTTTAC
TTTGGGTTTCATAACTCAACAATCTTCCCTGAGGCCCCAGGTGAGAACAGTGAGTTAGCT
ATGAAGGCAGAAATAAGTAACTAAAGATCTTAGGTGGTTAATATTAACTGCCTTTTCTTT
CGTGAATAAACCATATCACCTGGGATTAATGGGTGAAACGCAGAGAACTATTAACTAAAC
CAGGGATTGGCAAACTTTTTCTGTAAGGGCCAGATGGTGACTATTTCTCAGCCATAGTGA
TGCAAAATCAGCCAGAGAAACATGCAAACAAACGGGCGGGTAGCTGTGTTGCAATAAAAC
TTTATTTACAGCAACAGTTGGAAGTTAAATTTGGCTTGGTGGCTACAGATTGCTGACCCC
TGAATGCAACACTCCATTTTCAGGTCTAAGTATTCCCATTCTCTTAAACACACCATCCTA
GCTCAGGATGCTCTAACAGAATACCACAGACTGGATGGCTGAAAGAATAAATGTTTCTTT
CTCACAGTTCCGGAGGCTGGGAACTCCAAGATCAAGGCGCCAATAGATCCAGTGTCCTGC
GAGGGCTGTCTTCCTGGTTTGCAGACAGCCTTCTTGCTGTGTGCTCGCATGATGCAGAGA
GAAGAAAGGGGCAAGCTCTCGGGTCTCTTCTTATATGGACACTAATCCCAGTCACTTGGG
CTCCACCTCATGACCTAATTACTTCCCAAGGACCCCACCTCCTAATGCCAACACACTGGG
GGTTAGGATTTCAACCTGTGAATTTTGGAGGAACACAAACCTTTGGTCTGTAACACACAG
CATGCTTATATAAAAGGAAGAGATGTCCACCAAAGTTGTAAGGTCCATATGGCACAGGGA
CCAAATTATTATTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved