Homo_sapiens Locus Mono:92:AL096709.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:92:AL096709.11
Homo_sapiens
Mono:92:AL096709.11
6
SNORD3@L39
1001..1212
2212
GGGCAACACAAATGAAAAAAAAAAAAAGATCCAAAATGCAAATAGACAATTCACAGAAA
ATAATACCTTAAAGGCAAAAAGAATAAAGAAAAGATTCCAAAATACACTGATAGCGTGAT
TCACTTTAAGCCTATCAGACCGGCAAAAATTCAAAAGTTTATCTTACCAATCACTGATGG
GGAGTCAGAGAAAAGGGTATCTTTGTACACTGCTGATGATAATGTAAATTTGTACTGCCT
TTTTGGAAAGCAATCTGGAAACATCTGTTAAAATCAAAAATATGCATGGAAATAAAAGCT
CAGTGTGCTAGTTCAGGTCAGTGTGCTAGTATGCCACATCAAGATTAACATGCAAAAGAT
TTATTAGAGAAAGTGCCTGTGAAGAATGATGACAGAGGAAGCAGGAGTAAGTGGAAACTC
TATGGACTGTGATGCAGATCTGATACCTGTGAAAGGAGAAAGGGAAGGAAGGATTGCGTA
AGAAGAGCCTGAGACTGCAGCACAACTCTGAGAACATTTCAGCTGTGCTGATAAGGAGTC
CCCAAGCAGACTGCTCATTAGAAGAGTCCTGCATTGCAAAAGAATGAGACACACTCAGTC
ATTGGCTGGGGATTACAAATCCTTGTAACAAATTGCCTTGTTAACGAATGTCATAGTGAT
GAACCAAAAGAGCAAAGAGCTAGAGACTGTCAATTAACTATGCTCGCTGCAGCAGGGTAT
CTCAAAGAAGATCTAAGTGGCATGAGCACAGAGGCATGAGAGTATGGATATGAGGATATG
GTGTTGAGAATTGTTCACGATGGCAAAACAACTAGAAACAAATTAAATACCCAAATTAGG
GGAAAGGTTGAGTAAATTAAGTCCTATCCACGCCAAGGATTAATATGTAGTTCATCAAAA
AGAGTGAAGTACGCCTTACTCTTGATCTAGAGGAGTTTCCACACATTAATGCTAAGAAAG
CTAGTGTATGACAGCAACTCATTTATTAAAAATCAAAGACCAAGACTACACTTTCAGGGA
TCCTTTCTTCAGTTCGTTACTAGAGGTTTCTCTGAATATGTAGAGCACCAGAAACCACTA
GAAGGAAATGCAGTGTGCTCTCTCCAGAGTGTGAAGCCAACCCTTGGTGTTGCTTGGCTG
CAACTGCCGTTTACCATTGACAATTGTTCTCTTCCTCAAGAAGAATGAGAGGGAAAGAAG
GCAGTCTGTGTGATTCCCATTAAAAAATAATAATTTTTTAAAAAATAAAAGACCAAAATA
CACAGTTACATGAGCTTAACAAAAAGTGCACAAGGCTACAAACCAGGCTGCTGGCCTGGT
TTATTCATTAAAAGCCAAACACTAGAAACAGTCCAGATGTCCTTCAATAGGGATGGTTAA
ACCCTTTTATCACAGCCTGTCCACGTGACAGTCCTCCCACTAGACCAGGAGCCCCTTGAG
GATTGCAACCTAACATGGCACCTGATACTTTCTGCTTAATAAGTACTTACTGAATGATTA
AATAAATGAATGAATGAACTCAAAGGGAAGTTATAATTAACCAAATGGAACAGAGATAAG
AAGCAGACATAGGAATCTTTTATACCTAAGAGATTGGAACTGGCAATACGCTATGAATGT
AAAATCATGTATAAGCTTTTTATTATTAAATGACTTCCATGTCTCTTTATTCATTATTTT
AATGCAAGTATTTCATCCCTCAGTTGTTAATCTACTTTCAAAGCCTAAAAGAAAGTTATC
TTTAAGGTACCATAAAATTGTCACATTACTAAGGTTGAAAATAGAGTACCTACAACTGTT
TTTTGAAAATAGAATCTTTTATCACTGGGCAGTACCAGCAATAGACATGCTGTTAGAATT
CGCTGTAAATACAGTGACTGGCAAGTATGTACTTGCAGAGTCAATAAGCCTTCATTTCAA
ATACAGACTACCACCATTTAGCTGTTCTTCCTCAAATACCTCTCTGCTGCATCCCAATTA
ATTGTCAACATTTACAATCACCTGGCCCCACTAGGCTTCCTTCCCCCACCACAGAGCTCT
CACCCACTGACTCAGCAAGAGCAGTTAAGAACATGCATAGGTCACAGGATGACCACAGTT
ATGTCCACTTCCACAGTAAATGTGACAGTTCACATGTCCACCAAAGGTAAAGGAAAAAAA
TAGACAAAACAACCTTGCTATCAAAAGTCTACACAATGGCAGTCTCATTCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved