Homo_sapiens Locus Mono:114:AC124016.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:114:AC124016.3
Homo_sapiens
Mono:114:AC124016.3
4
SNORD42BL1
1001..1069
2069
AAAAGAGAGATCATTTAGTTTAATGAAAGACTCCCTCCCTCCCCAAACATCCTTCATTT
CCATTCTTAGGGGTTTAATAAATATTGGCTGCTTTATTCTATGAGTTGGCAAAATTGTCA
AGGGCCCAAGTTACTGTTTCAACCAGGTGTAACAACTTGTGTGTGTGCAAGTGTATCCTG
AAATGGGTTTTTCTATATCTAAACTTCTTCCCTCTCCTTAGAGCAGAAAGATTATTAGCT
TTTCTCCAATAATTGTATATGTATCTATAGCTGGCTCTTGCTTTTTCTTTTATTTTCTTT
TCTTTCTTTTTTTTAAAGAGACAGAGTTGCACTGTGTTACCCAGGCTGGAGTGCAGTGGC
TATCCACAGGTGTGATTACAGTACACTACAGCCGCGAACCCCTGGCCTTAAGCGATCCTC
CTGCTTCAGCCTCCTGAGTAGCTGGGACTACAGGTGCATGCCACTGTGTCTGGATTCTTC
TCACTTTCTTTTCCTGTTTTCTCCCTCCTATCCTCCCTCAAGAAATTTTAAAGGTGAATT
GACTTAAAAAAAATCATTTTGTTGTCATGTGTGCACTCTAGAAATATCTAGTCCACATAA
ATAATCAAAAATTTCTAAACAGAAAAAGTTAAAAATGGTATTTTGTTATGTAAAAATGCT
AACACTGTATTTTAATTTTCATAATACTGAAGTTAAATTTCTAATGCTTTAAACTTTCTA
AATTTTTATATTGGGCTTAAGAGTCAAATAACTTATTATTTCCAAAAATTGTTTAAGATT
GGAAATATAATATGGTGTTTAATTAAATAAAAATGTAATTACAGATGTCTTTTGAAAGGT
TTTGATTATGTGAAATTCCTGTAATACTATAAAATGTGTTAATTAAAATTTTAATTTCCA
AGTTATTAAATCTTTAAGAACTTATAAAACACATTAATTGATATATGATCTTTGGATACT
TGAACAATTTTAAGTTAAAAAATGATACAAAACTCTGGTCATAGCATATGATGGAAAAAT
CTTAATCTTCTGAGACTTGTGATGTCTTCAAAGGAACCACTTCAATGCAATTTAAAGAAA
AAGAAAAGTAAAAAAAAGCCCTCCCCAAGATGGCTGCTGAAGACGAACTACTGCTCCCGC
TGCCCCCCGCCGAGCTGCTGGAAACCGGCAAACAGATTCTGGACGAAGTAGAAGTAGCGA
CTGAACCTGCCGATTCCCGGATAGTCCAGGAGAAGGTGTTCAAGGGCCTGGATGGATCTC
CTTGAGAAGGCTGCCGAAATGTTATCGCAGCTCGAGTTGTTCAGCCGAAATGAAGATTTG
GAAGAGATTGCTTCCACCGACCTGAAGTACCTGGTGGTGCCAGTGTTTCAAGGAGCCCTC
ACCATGAAACAAGTCAACTCCAGCAAGCGTCTAGATCATTTGCAGCGGGCTCGAGAACAC
TTTATAAACCACTTAACTCAGTGTCATTGCTATCATGTGGCAGAGTTTGAGCTGCCCAAA
GCCAAGAACAACTCAGCCGAAAATCACACTGCTAATTCCTCCATGGCTTATTCTAGCCTC
GTTGCTATGGCATCTCGAAGACAGGGTAAAATAGAGAGATACAAGCAGAAGAAGGAGTTG
GAGCATAGGTTGTCTGAAATGAAACCTGCTGTGGAAAGTGGTCAAGCAGATGATGAGCGT
GTTTGTGAATATTATCTTCTTCACCTTCAGCGGTGGATTGATATTAGCTTAGAAGAGATT
GAGAACATTGACCAGGAAATAAAGATCCCGAGAGAAAGAGACTCTTCAGGAGGCATCAAC
TTCTAACTCATCTCACCAGGAGAGGCCTCCAGTGAAACCCTTCATTCTCACTCAGAACAC
GGCCCAAGCCAAAGTATTTGGAGCAGGTTATCCAAGTCTGGCAACTATGACGGTGAGTGA
CTGGTTGAGCAACATCGGAAATATGGAGCATTACGAGATCAGGAAATAGCCAAGGCAACA
CCAGAGGAATTCAGAAAAGCGGCTCAGCAATAGGAACATCAAGAAGAAAAGGAGGAAGAG
GATGATGAACAAACACTCTACAGAGCTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved