Homo_sapiens Locus Mono:147:AC004125.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:147:AC004125.1
Homo_sapiens
Mono:147:AC004125.1
16
SNORA1L1
1001..1133
2133
GAAGGAGAGGATATCAGTAGAGCCTCTTGATGGTCTTCTCACATCCATCTCCTCTGCAC
AGCCCACACGGAGGGTCCTGGGGCAGATTTTGGTGGCTGTGAATCCACGAATCTAACAGA
GAGACATCACTTCAGAGCAGGCTCTGGACAGTCATGATGTGCTCAGAGTGAGGGCTGGCA
CTCCTCACCAGCCCACCTAGCCCAGCCACAGTGCCTGGAACCTGCTCCAACCCATAAACA
GGGCCAATTCTGTAGCCAGAGCTTGACATCCATCTCAGCATGAGTCCAGCCAGTGCAACC
ACATTCCAGGCCCCCAAAAGCCCAGCTTAGAGCTCAAAACAGAGGCCAACAGGAACCTAG
GGTCCAGCGTTGTAGGTCTTTTGCTAGAACTCTTTTGTGAAGATTTTTGCTTTATGATAT
CAGGAAGGAAGAGCAAATATCATTTGTGTTTATGCTTCCTGAGTACTTGGGTTAAGCCCT
TGATTAAGAATGTTTGGGCCCCTGTTGTTACAACAGATCTTTATTATCTGAGAATAAAGA
TGCCTTACAACAGTGATTCTCAACACTGGTTCACATTGGAATTACTTTGGGAAGGGAAGC
TTGAAAAATGCTGAGGCTGGGGTTCTGCTCCCAGGGATTCTTACTTTATCTGGGCATCTG
AATTCCTCTCCTGTCCTCTCCTCTCCTCTCCCCTTCCTTTCTTTTTGAGAGATAGGGTCT
TGCTCTGTCACCAGACTGGAGTGCAGTGGCACAATCATAGCTCACTGCAGCCTCAAACTA
CTGGGCTCAAGAAATCCTCCTACCTTAGCCTCCTGAGTAGCTAGGATTACAGGTGCACGC
CACCATACCCGGCTAATTTTTAAATTATTTTTTTTTGTAGAGATAGGGTCTTGCTATGTT
GCCCAGGTTGTGGATTTTTCAAAGCTCCTTGGGTGATTAACTGTGCAGCTAAGGTCAAGG
ACCACAGCCTTCAGGTGAGTCCACTCAAAAATAGGGACTAAAGCCTCTTTCTAGATGAGA
ATGGGCACTGTCGATCATGGTGTCTGAAAATTGTAAGTGGCTAAATTGAAACACAGGTTA
TGCTTCCATAAGAGTATATGTATTGCAGTGGTGACAATGAGACCTGTAACACTTTGAAAA
TTTTTTTAAGAGAATAAAATAAAAGAAAAAAAACCCAGGGCCTCCTATTCATAGTAAACA
ATCAAGTCCGAAAACATGCTTCCAACTTTATCTGAAAATGAAATTATAATTCAGGAAAAC
ATGCTGATTTTTTTCTGATCTTCTTTAACTATGTACTAGGGTAAACAAAAAAAGTAAGCT
TTGTTGATTTCGGAGTGGCAGGGTTGGGGCATGCATAATTTTTCTGATAAAATTGCGTGG
TAGTCCAGTATGAAATCTTTCCCTTCCCTGACAAGATCATAAAGTTTGACTTTCACAGCA
GGATCATAAAATGGGTCATTTTTGCAAGCAATATTTGAGCCTGTCATCAGTTTTCCTAAG
GGCTCCTGTTAATCCTTTGATATTCAAATCATTGGATGTGTCTATCACATCATCATTCTT
GTCAATTTTCTCTTCTTCCATTGTTAGCTTGTGTCCCTCCAGCAGGCTCTTGTCTACCCG
TGGTTAACACATCACGTTTTGCCTCCTATTTTCGTTGTTTTGTCACGTGTTGACAAGAGC
TGGCAATCAGAACCAGGCTGTCAGACAAAAACCGCGAATTGCAGAGTGTTAAATGGGGCA
GGGGTGTGGAGTGGAGTAGGGAGGGGGTGCCTGTGTAGGGAATGATTTTATAACTGGTCC
GGTCATGAATGCACATATTCATATTAAGACAGAGTTTACTTGCCTGTCCGTGCAACCTTG
CGCACACAGGGATTTGGATAATGAATTCATAGTAACAAGGACCCTGAGCTGAGCTTGGCC
CCTGATCAAGATGAAGCACTTAGGGTATAGCAATTACAAATTACCGCTTCTAATAAGAGA
ACAACGAGTCAGTTACTGAGAAATAAACATTTTCTTCTGGTGTAAAGAACTGTGGTTGAT
GCACATCCTGATTTATTCTTTTCTCATTCTTTTTTTTTTTTTTTGAGACAGGGTCTTGCT
CTGTTGCCCAGGCTGAAGGGCAGTGGCACAATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved