Homo_sapiens Locus Mono:206:AL590229.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:206:AL590229.3
Homo_sapiens
Mono:206:AL590229.3
X
SNORD45BL2
1001..1072
2072
AGCATCTTTGCATTTACCTGTGGTTTCTTTAATTTTTTACATAATTCTTTTATTATTTT
CAGTGTAAAAACCTTTCACTTCTTTAAGTTTATTCCTAAGTATATTTTTTGCTATTTTAA
ATGGTATTGTTTTGTTAATTTTTTCAGATAGTTCATTACTACTGCATAGAAACCACTGAT
TTTTGTATTTTGATGACATCTTTGCATGAATTAAAGACTTACACTTAAGAGGTGAAACCA
TAAAACGACTAGAGGAAAACATAAGAAGAAAGATTCTTGACATTGATCTTGACAATAATT
GAACATAACATCAAATGCAGAGGCAACAAAAGCAAAAAAAAAAATAGACCAGTGATACTA
CATCAAAATAAAAAACTTTGGCACAGCAAAGGAAACAATCAAGAAAGTGAAAAGACAACG
TATAAAATAGAATAAAATATGTGCGAACCATATATTTGATAAGGGAATAATATCCAAAAT
ATATAAGGAACTCATAAACTCAATACCAAAAAAAACCCTATTAAAAATGGATAAATGACC
TGAACAGACATTTCTTGAAAGAAGACATACGAATGGCCAATAAGTATAAAAAAAGGTGTT
CAACATCACTAATTCTCAGAAAACTGCAAATCAAAACCACAATGAGATATTACCTCATGC
CTGTTAGAATGGCTACTATCAAGAAACAAAATATAGAAAGTGATGGTCAAGGTGTGAAGA
AAAGGGAACTTTTCTATGCTGTTGTTGGCAAAGTTGGTGCAGCTGTTATGGAAAACAGTA
TGGAGGCTCCTTAAAAAGTAAAAAATACAACTACCTACCATATGATCTAGCAATCTCACT
TATGTGTATATATCCAAAATGATTGAAACCAGGATCTGGAAGAGACATTAACACTCTCAC
ATTCATTGCAGCTTTATTCACAATAGCTGAGATATGTAAACAATCTAACCGTCCATCAAT
GGATGAATTGATTTTTTTAAATGTGCTATATATACAACATTGGTCAATGATGTAATGGCA
TGTATTAGCTGAATCCAAAGTTGAAGTGAATTCTAAAATTACACCAAGACCTTGGGGGAA
AAAAAGAAAAGAAATGTAAAAAAAAGAAAACAAAAGTGCTGTATCAACGACATAAACCTG
TTGGCCCGGCACAGTGGCTCAAGCCTGAAATCTCAACACTTGGGAGGCCAAGGCGGTTGG
ATCACCTGAGGTCAGGAGTTCTAGACCAGCCTGACCAATACGGTGAAACCCTGTCTTTAC
TAGAACTACAAAAATTAGCCGGGCTTGGTGGTGTGCACCTGTAATCCCAGCTACTCGGGA
GGCTGAGACAGGAGAATCGCTTGAACCCAGGAGGCGGAGGTTGCGGTGAGCTGAGATCAT
GCCACTACACTCCAGCCTGGGTGACAGAGCAACACTCTGTCTCAAAAATAAAATAATAAA
ACAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAACCTGTAAGAC
ATTATGCTAAATAAAATAAACCGAGCACAGAAATAAAAATAATGCATCATCTCTCTTATG
TGTGAAATATGAAATAATCAAACTCATAAAAACAGATAGTAGAATGATGGTATCAGAGGC
TTGGCGGAGAGGGAAATGGGAAGACTTTGGTCAAAGAGTACACATTGTCAGTTATGCAAG
ATGAATAATTTCTGGAGAGCTAAGGTATAGCATAAGCACACTCACCATAGTTAACAACAT
TGCTGGTATATTTAAAAGTTTTTAAGAGGGTAAACCTTAAGAGTTCTTGCCACACACACA
CACACGCACACACATGAAAAAAATAGAAAAGGAAATGGTAACTATGTGAGGTGATTGATA
TGTTAATTAATTTGATTGAAGTGATTATTTCACAATATATGCATATATCAAAATATCAAG
TTGTTCATGTTAAATATATACAATTTTTGTTAGTCAATTATATCTTAAAGCTGAAAACAA
TTTAAAAGTTTTAAGTAAGCAAAAAAGTTTTGATACCTTTCAAAATCCTCACGTCCAATT
ACTATCACATAGGGAATTAGACATCAACATATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved