Homo_sapiens Locus Mono:182:AC011891.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:182:AC011891.3
Homo_sapiens
Mono:182:AC011891.3
7
SNORA64L2
1001..1132
2132
AACTAAAATTTTTATTTACAATGTTTGGCAGTCAATCAGATAAAAAGAAGAAATGTAAA
AGGGCAAAAGTTGATTAAAATAAGAGAGAGACCCATAGATACCTAGATGTTGATGTTATC
TGACAGGTGCTTCAAGCCATGTATTCAAGAAGCTCTACAAAGCTCTAACAAAAGAGTACA
AAGAAAACCATCCCTAGACACATAGTCCCACTGCAAAAGCTAAAAACAAAGAAAAATCTT
ATAAGCAACCAGAGAATAAACGACATACTACCTTCACAAGAGCAAAAATTAGACCAACAG
CTGACCTCCCAACAAAAACAATGGAAACAAGAAGAAAATAGAATGACGTGTGATATTATG
AGATATATATAAATAGATTTTATAATATCTATATATATGGGCTTTTGTCCATAGTTCCTG
GCTTATAACTCCCATATCCCTTGTTACAGTCTTTAGTTATAATGTTGGGGCACTTAAAAC
CTCAGATAACAGGCCTCAGAAAACAGAATCTCTCTTACCTCCTGCCTCCTTTCATCTGCT
CCTCCTCTTCCAAAGTCAGAAATCTTCCCTGCCTTTCTGTCTTAGAGCTGGCCATAAAGA
AATTCTCTGACTTATGTGATTGTAGGTCATAAGACACCCATTTCAGAAGAGGTCCTGCCC
CATTCCCTGGAGGAAAGAATGTAGCAGAGAGAGGACAAAAAGAATCTGAACAGATAGACC
TTGCTGGGTTTTCCCACTCAGCCTATTAGTATTAGATCATACATTTTGTGTCTAATCACA
TTTCTACACAGCTGTCGATTTTGCCTATCCAGTGAAGCCTCCATAAAAGACACAAGAAGA
CTGGGTTTCAAGAGCTTCTGGATAGCTGAACACATTGGAGGCTCCTGGAGGCTGGTGGTC
AGGAAGGGCATGGACACCCTGAACCTCTTCCCCTATACCTTGCCCTGTGAATTTCTTCAC
CTACATCCTTTGTAATACCCTTTGTAATAAACCAGTAAATAACACTCTCAGCTATGTATA
GTTACACCTGGCTTCACTTGTGTGACTTTTGCAATGGGAAGAGAGAGAGAAGGTCCCCTT
GGTACCTCAGCTCGGCCTTATGGTGGCCTCTTTCCTTGAAGGGTGCAACAAAAGCAGGAG
GAAAAAAAAAAAGCAAGGAAATAAACTTATATATTCAGTTTCCCTGAATTCTGCGAGCCA
CTCTAGCAAATTAATCAAACCCAAAGAGAGGGTGTGGAAACTCCACATTGAAGCTGGCAG
GTCAGAAGTTCCACAGGCCCAGACTTGTGACTGATGAGGATCAGGGGCGGTCTTGGGCAC
TGAGCCCTCAACCTGTGTTTTTTTTTTCTTTTTGAGACAGAGTTTCACTCTTGTCGCCCA
GGCTGGGGTGCCATGGTGCATCTCGGCTCACGGCAACCTCCGCCTCCCATGTTCAGGCAA
TTCTCCCGCCTCAGCCTCCTAAGTAGCTGGGACTACAGCCGCCTGCCACCGTGCCCAGCT
AATTTTTGTATTTTTAGTAGAGATGGGGTTTCACCACATTGGCCAGGCTGGTCTTGAACC
CTTGACCTCAGGTGATCCACCTGCCTCAGCCTCCCAAAGTCTTGGGATTACAGGTGTGAG
CCACCGCACCTGGCTTCAACCTGTGGTCTTATGTGCAGGAAAATAGTGTGAGAATTGACT
TGAATTGGAGGACACCTAGGTGGTTTGTGCTGCAGAATTGATGGCTTGCTTGCTTGCTGG
TGAGGAGAAATCCCCACACATTTTGTCACAGAAATCTTCTGTCTGTGATTATTGTTGTTG
AGAGGATAGCTCACTTTCTCAAAAATACTTTGAATTTCTTTCCCCACTCTCCTGACATAC
TTTGGCAGATTTTTTTTAGAAAATATATTAGAAAAATTTTTGGAGATTCGGAGCAAATTG
AAAAACTCACAGATGAACTGCATCACCTAGAAAAGCAAAAAACTTTTAAAAAGGTATGTC
ATGAATGCATAAAATATATGTAGACATAGTCTATTTTATTATTTACCATCCTAAAATATA
CACATCTTTTATAAAAAGTTAAAATTTACCAAAACTTTCCCTCACACATTTACAGACCAT
ACATGACACCACTTGCTGTTGACAGAAATGTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved