Homo_sapiens Locus Mono:286:AC013603.17
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:286:AC013603.17
Homo_sapiens
Mono:286:AC013603.17
8
SNORA70BL3
1001..1115
2115
GGCTGGGTAGTGTTGATCTGTGTGACTCTGAGGTACATGAATATTTATGGAAAGAAAGA
CAGCATTGCAGACAGGGTATGGATTTCCCATGATCTCAGAAGGATGGTAGCTCAGCATCA
ATTTAATGGGAGGAAAACTGTAATTTCTAGAATATCTGAGTTTGCAATGGAGATTCATGC
TTACAACATAATACTGATGACCACCAACTTGCTTGTCTCTTGGTCTTTGTCCCTCCAGAT
TTAAAAATACTCTTTCAATTTCTTCCTCATGGCAGCATATATATATATATATATATGCTG
GGGTCTCACTATAGTGCCCAGACTGGTCTCAAACTCCTGGGCTCAAGCGATCCTCCTGTC
TCAGCCTCCCAAAGTGCTGGGATTGTAGGTGTAAACCACTGTACCTGGCCCCTCATGGCA
CTTTTTACAGCCTCCCTATTTTTCTGCAGATGTAAAATGAGAGTAAAGGAATCCAATAGA
AATTTGGTCAGTATTGAAGGCAGAAAGGACTTCTCGGCATGTTATAATTGTGCTATTGCA
TTTTGGATTCATTTTGACTTTTTTCTGCCTTATGACCAACTTGACATCCACTATGCTTTC
AAATCAATTTCTCCTACACTTAAGAAAATCTAGTTTTTTCTTCATTTAGGTTGGTATTTG
ATGGCCGCCTTCACATTGCATCAAAGTCGCCATGGATTCTATTCCTGTCTTTGAGGATAT
CAGCATCATCTTGAGAAATAATAGACATATATAAGTAAACATTCAGAAACTCAGAGCTGG
TTGCTGTGGGGGCTTAAACCCACATTTGGGTTAAACCATTTGGGTGTACTCTTAGTAATC
TGTGTATCCTTTGAACTATTCATGACTATCGTAGCCCATCAGGAGGGGTTTTGCAATGGC
TTGGCATTCTCAGCCATGATAGAGACTAGACTGCGATGAAAGGTGAAAAAAAGAGGAAAG
AAAGGAAGAGGGAGAAAAAATGAATGGGAGAGGAGACGAGATTGATAAGAAAGAAGTTCT
GATCCCAGTGTGCAATGGCTGCAAACAGCAGCTTTCTTGGTGGTGTACATGGCCTGTTTC
TTGTATGGGTTGCTCTAAGGGTCCTTGGAGACAGGCCTTTCAAATGTACGTTCATGTCTC
TGACCTTGCACTACCCCCGATGTAGGCTCGAAACAGGCATTCAAGGTGCCTTTGGAAAGC
CCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTAAGTCCATCTGCACCAAGCTGC
AGAACAAGGAGCATGTGATTGAGGCGCCATGCAGGGCCAAGTTCAAGTTCCCTGGCCACC
AGAAGATCCACATCTCCAAGAAGTGGGGCTTTACCAAGTTCAATGTGGATGAATGAGAAG
ACATAGTGGCTGAGAAGCAGCTCATCCCAGATAGCTGCAGGGTCAAGTACATCCCCAGTC
ATGGCCCTCTGGACAAGTGGCAGGTCCGGCACTGGTGAGGGCTTCCACTGTGCTGCTCCC
CACCCCCTACCTTTTTTTTTTTTTTTTTTTTTGAGACAGAGCCTTGCTGTGTTGTCCAGG
CTGGAATGCAATGGCGCAGTCTCGGTTCACTGCAACCCCCGCCTCCCGGGTTCAAGCAAT
TCTCCTGCCTCAGCCTCCCAAGCAGCTGGGATTACAGGCGCCTGCCACCACACCCAGCTA
ATTTTTTGTATTTTTAGTAGAGATGGGGTTTCACTATGTTGGCCAGGCTGGTCTTCAACT
CCTGACCTCGTGATCCGCCCGTGTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCC
ACTGCACCCGGCCTCTGCCCCATCTTAATACCCACCAATAAATGCTACTTCCTGTCCAGG
TAAAAAAAAAAGAAAAAAGAAAAAGAAAGAAAGAAGTGCTGATGTTTAGCACCAGAGAGG
TGCCGAAGATGGGAAAGTGTGCTCAGTAGTCATCAAAAACATCTTCTAGTCCTCCTGGCG
CTCTCCCTCCTCTACAGAGCACATGCCCTGGTTTCTTTTCTTTTTCTTTCTTTTCTTTTG
AGATGGAGTCTCACCCTGTCTCCCAGGCTGGAGTGCAGTGGCGCGATCTTGGCTCACTGC
AACCTCTGCCTCCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved