Gorilla_gorilla Locus LOC101135287
snOPY snoRNA Orthological Gene Database
Gorilla_gorilla LOC101135287
Gorilla_gorilla
LOC101135287
5
SNORA13
1943..2075
5734
ccttgccctgtgtgacaaggccctaagtgccttgctcctgcctggctctccagccgcat
cttgtcaatctgcactccttactctactccagccacactggccaaggcctgctgtcccca
gatcttgcataaccgccttcacacatctgctcggagttcacctccagtcttcctatccgt
agccccatgagctactgaacacttgaaatgtgtctagtctgaacggaaatatgctggaag
tataaaatatacaccggatttttaagacttactagattaaaagaaatatcttattaataa
tcccatattgattgcctgttgaaatatttaaaatatgttgggttattattaaaattaatt
tgatctgtttctttttactttttttttttttttttgagacggagtttcgcccttttgtcc
aggctggagtcaagcggcatgatctcggctcaccacaacctctgcccccaccccgcccgg
gttcaagcgatttctcctgcctcagcctcccaagtagctgggattataggcgcccgccac
caagcccgagtaatttttgtatttttagtagagacggggttttgccatgttggccaggct
ggtcttgaactcctgacttcaggtgatcacctgcctcagcctgccaaagtgctgggatta
caggcataaaccaccgcgcccggccttcttttcacattttatgtggcaattggaaaattt
aaaattacactcatggctcacactgtttccatcggacagcgctaccctatggcatgaccc
tcttttgctgccctcctggcacttacattgtagaatttcagcatccgggctcacctggtc
agtggccttctcacccaagcagaatgtaccacagaaaccttgcctggctcacccacacct
gattcccaggcactcaggccagggcctggagcatagtaagtgctgactaaatatctttcg
aatcaatgaccctactcttcctcagctggacacataaattctgtcgggtcccaaaacacg
tggtgtaaagtcctttgggctcctgccgctgccagcgctgaccatgtgctcttgaccctg
gtcgggtggggggatgtctggatacctcctctgtggaaagaactggccacacatccgcag
aggtgactcgggctgagaacccaggctcctcttccctttggtgacacgcccctcggtccc
tcactggcacttctccctccggccacacggcggcgtctctccggagcgcagcggccgatg
gtacagcccgctcccccctcgcgctctcggacagtgggtccttccacttgtagaaaagca
ttatgggacggaagcgtgtcctttcttctttttggttcgagcttggtgtggtttttgctc
tgggtcctctggaatggcgcctggctgtggccgcgtggtctctcacgcaggggcgccggg
cgggggaacgcggccaccctgagtctggtgagtcgactgcggcggcctgtgtccgaagtg
tccggggcggtgaacaaaggcagcggcctggcctcaggcctgcgttcccacgtttggaaa
cggggagcttcgtggatttgttgccagggagttctccagataagcctggttttattttcg
ttagtaaaaaggccttaccgtataactgactttatgcttgccctgcccccgtgtaaaata
acttaaaagcagagtgcctggttacagctgtttccacgtgcggtgctcgtcgggagtgat
cacctaccctacaggtgagttttcacgttcgtgcaagaccagtcgccatttaaaacgcat
cgcatttcacttttcattattaagtcggattttaagtcgtgagaaaatttctttgaaatg
tgttgtccgtttttaggctgtaatcgggattactgtcagccagtcagcaaccttaggcca
taaagccgacctcacgcagtgtcagcctttgtgttgcccattcgctttggaaactagtga
atgtggtgtcaaaaaaggcgtaaattaaacgctttgcagccttttcctgcccttaaattt
gatatctttggtgtaggagctgcataagtaacagttgctgcttttacgttgacacgcgtg
atcttgaccctgccagccttaagtgtatggtttctcttagccagttctaatttttgttca
ggtggaagatggatgcctgaagtgtagactgctgctagctgaaaaccatctgggagcata
aaggtgacctgaaggtagggtgatatgtcttaaagcactttgtaatgggaatttttatca
ccttttaaattggggttccttctctagtgagttttaatgttagtggtacattcgtagtgt
tgctctgtctgtagctattaaggtgagttaataaatgggacagcctccacagcttatttt
tgggaaggttttgctgatacttcctgagaagcccagggaaataaatacgcatagtactgg
cattctgcatctctttaagatttgtttttatgtgtagtaattgaggttttttaaaaactt
gtgaaatcgcaagcatattaccaagttcttgattaaaatgtaatacaaaaatacttgctg
tcgaattgagtactttattttttctcttaggatgtccttggtgaggattttgaaaatttg
atcttcacaagagttgcttggatcatttgaaatttctgggagtctgaggagtactgacat
aattgcctgctggagtctgtaaatacacatttaagacagtgaggatgtgaataaatatat
taatgcactttggcatttgtgttttaagtgattaactgccagaaatagctatttctaaaa
agttataagggaggaggggttcttttttgatcagtattcactgctgtcaccataattaat
agccttaacaatagcttgtgtttggcccaaagagaaatgtactttcttccagtgactcca
aaatcgtggctagaactagactgatttctaatgacaggtgtgctttactgcactcaatgc
gtacttttccttcagctaaactgtacgtttaatgttggcatatcttctgcctttgctttg
caggaaacaacaaataatgtatagaggtattcaaaaaatttattgaaagcactgtactag
gagctgagaacacgatgatgagcacaacacagttcttccctttggaaacatagatgagtg
gagggaatgtcatcacaaatgtaaaacttcactgtgagttccatgataggattttcttag
ggaaacctgagaaagagttgagactaaaggtatgtgtcatatttttcacaaggcaaaact
gagggaatgacatatacagaggcttgggctagaaaaaagataccgttagtccacttactt
ttgagacagttttggctgctttccctcttcagtgccctgttttagaactgagtccttact
gagacttgtaagatggccattatgggaggtgggagtgttacaaaatgaggctgaagaggt
aggtaaagaagccagaccacttcaggctccctctggctttattaaagcaagataaatcca
tggtggaaaatcagatttgcaagaaaaggtagttgaactaggttgcttattgttgtctag
acaagagaccagcttggactagtaaaattagtgaaataagatcgtttatagttggatgac
agagccaactagacgtggtaatagtggaggtgtccataactgctaggtgtccagcttgca
cactgatgagcataatgaccctagattcagctggggagcagcatttaaacagttgaattt
ttaaattactttgagaaatccaagtggtctttttgcagtagcacattactcagtagtcta
aactacagaaataaaccttaaggccatgggtataaatgagatctgctggtggtagaggaa
gagggcctagggtctgaagtttgagaaactccactaattaatggcaaggtaaagcatgat
aagccagaaaggatggtcagtggtaggagcaaaataggattatattaaagaagcaaaaga
atgtccaaaaaattctccctgggattaagtaacacagtgatggatattagtggagtagag
ggaaagatccatgttagagatagcttaagatagggattagatgaattgagggcaatgact
aaagatactgcttgcaagaaaattggctgagaatgagaggaaactcttagttgcttgggg
ggagggggtttgtggttgtgaaagatagttttctttaatcttggtcttaaatttaaaacc
aagtagcaaggatctagctgagagaataattgaatacattaatataggagaaggacagac
aaagatcctgaaaaggctgggagaagagcatccaaagcacaggtggagagacaaaaaggt
tagggctgctggcagctgtggagagaactgtacgtggtaaggggtaaatataagatgtcc
tgcataagtattttccctgtagattgcaaagtcatctatggagaggaaaggtccaaaata
gtcactggggagagcaggtgaattagatggccaagcagggtggatggatcatttgaggtc
tggggtgacagatcaactgagaatccacttagacttctgaaaacacaagaacactttaga
aattaacaacacttaaagctttttacatcatttgtaaataactggtggaacttaacacca
caaaatacagtattataaagaactttatatgaataaaaatatatgcagtctgaaagtgat
gcctcagtcctttcgcatctgggcactagttgagaaccagcccagccctgggaagacgtc
ctcccacttgtactattgcacagcaggctagctgcagttcagaattccagaatgttcatc
agatgcatctggtcttggttgtggtggacacagacacaagatagaaatgaatgattgcta
tcctgttccagaaatgaaaatgtggtatcaagtgaatttttacaaaatacttattcttcc
agttaaaacaaaaaggtccttcagcacaactgtgctgtagttaaaccatgcctataatcc
cagcactttgggaggctgaggcaggcagatcacttgaggtcaggagttcgagaccagcct
ccaacatggcaaagccctgtctctactaaaaatacaaaaagaattagccaggtgttgtgg
tgcacgcctgtaatcccagctgctcggtagcctgagacaggagacaggagaatcgcttaa
cccagtaagtggaggttgtggtgagctgacatggtgccgctgcactccagcgtgggcgac
agagtgataacatctcaaaaaaaaaaaaaaaaaagcaaaagataatgtattttctcatgc
tgaagaaatacttgcaggtctgagatttgaattaagatacctatttcacagtttcaaaag
taccagtggcgcacacaaccttcccacccctacccttgacccttcatcaggatcaagttt
ctgtcttgaggcgggaagcttgtacagtttttattgtttttgctgtgtgttttccagcca
ggttgtttgtagatgtctgaggtttttcttccatcaggctatctttagacccatttcttc
tctaaaataaaatacatttgaaaaatgtagaaagattcagaagaaaacagccaaatgaag
tattttaattacatcagaaaccaagctgctcttaaatgtaagatactgagttaattcaaa
agtttcataataccaaaagctattcagtaaatgtt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1753, 2161..2233, 2610..4734
NC_044607.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved