Gasterosteus_aculeatus Locus RPL17
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPL17
Gasterosteus_aculeatus
RPL17
scaffold_196
SNORD58
2137..2202
4289
ACCGTCAGATAAAACCACCGTCAGATATAAACACCGTCAGATAAAACCACCATCAGATA
TAAACACCGTCAGATATAAACACCGTCAGATAAAACCACCGTCAGATAAAACCACCGGCA
GATATAAACGACCGTCAGATGGAAACACCGTCAGATATAAACACCATTAGATATAAACGA
CCGTCAGATAAAACCACCGTCAGATATAAACACCATCAGATAAAACCACCGTCAGATATA
AACCACCGTCAGATAAAACCACCGTCAGATAAAACCACCGTCAGATATAAACACCGTCAG
ATAAAACCACCGTCAGATATAAACGAACGTCAGATGGAAACACCGTCAGATATAAACACC
GTCAGATGTAATGTATGTACAATGCTTAAATATTTGAATTAATTGAAGTAAAAAGTACAA
CATTTACTCGAGCATTAACTCTAAACTGTACTTAAATAGAGTATAAATGTCCTTGTGTCA
GCGACAGAAAGTCCCGGATGTTCCTCAAAGGAGGAACACGTGAGCTGTGACGCGTCCAGC
ACCGCCCCCTGCCGCCCGGACGGACTCACTGCGCGGTGTCCACGCCCCCTCCGCGCCGCC
AGGGGGCGGTGCAGCGGAGATAAAGCAGAAGAAGAGGAGCTGCGTCCAGGCTCTTCCTCT
TCCCTCCGCGGCCTCAGAGGTAAGAGACCCGTCCTCTCTCTCCACGACGACAATCTAGCT
TAAATCTGAACTAATTCATGTCCATCCCGCTTTCTTAACTTGTCGAGCTTCATTAAAAAC
ATTTGAAGATCTCGGCCGTTGTTGAATTTTTGCGTTTGAACGCGGGACTTGTGTTTTAGT
GCGGTCTTTCTGCGGATGCCGGTTTGGATGCTATCACGTTAGCTCTCCGCCATGTTGGCT
CACTACCTGCTTCACGTGTCCACGCTGCTACTGTAGTTCTGCCGGTTGAGTCATTATGTT
TAGTTAATCAAACCGCTCTCTGATCTTCCAGATATCTGAAAATGGTCCGCTACTCTCTGG
ACCCCGAGAACCCGACCAAGTGTGAGTATCCCCGGGTCGACTGTTCGTGTTTACCGGCTA
GCTTCTGTTAGCATTGTGGCTGTGATGATGTCTTAGGACACCTTTGAATTACGCATGAAA
ATGACTATTAAAGATCTGAGCTTCTTGAAGTTTAAATGTGTTTTAAAGAGTGAAAGTTCT
GCAGTAATTGGAGGGTCTTTATTTTTACAGCATGCAAGTCGAGGGGATCGAACCTGCGAG
TTCACTTCAAGGTAAGAGCAACATTAAGGACGCGTTTACTGAACTGTTAGTAGCTCAGGG
CTCACGGCCGTGATGATTATTTAGGACACCTTTGATTCTACTTGAAGATACAATATGATA
TCTGAGCCGTGCGTCACTAAAACTAATCAAATGTGATTTATAAGAGGAAGTAGTGTTAGT
TTGTAATTGATCCAGACGAAAGACTAATTGACGTTAAACGTTGTTTTCCCCGCCAGAACA
CCCGTGAGACGGCCCAGGCCATCAAAGGGATGCACATCCGCAAGGCCAACAAGTACCTGC
GGGACGTCGTCGTGAAGCACCAGTGCGTCCCCTTCCGCCGCTACAACGGCGGCGTGGGCC
GCTGCGCTCAGGTGGGACGTCGGGCCGCCGGCACGCGGGTCAGAGGGGGGCCGCTCAGGT
CTGATCAGCTGTTCTTGTCTCCAGGCCAAACAGTTCGGGTGGACTCAGGGACGGTGGCCC
AAGAAGAGCGCCGAGTTCCTCCTCCACATGCTGAAGAACGCCGAGAGCAACGCAGAGCTG
AAGGTACCTGAACGCACCGCCTGCCCATCACTAATTGATCGGAGCTGGAGGTGCCTGAAC
GCACCGCCTGCCCATCACTTAATGATCGGAGCTGGAGGTGCCTGAACGCACCGCCTGCCC
ATCACTTATTGATCGGAGCTGGAGGTACCTGAACGCACCGCCTGCCCATCACTTATTGAT
CGGAGCTGGAGGTACCTGAACGCCACGACCCGTCCTCACTTATTGATCGGAGCTGGAGGT
GCCTGAACACCCACACCAGTTAAATACACCTATGTATCTATCTCTATATTATATATATAT
ATATATATATCTATCTCTCTCTCTCTAGTGGTAGAGACAGCAGTGATGAGTATTTAGGAC
ACCTTTGATTCTACATGAAGATTAAAGATGAAATCTGAGCTGTCTGATAAATGATGAATA
ATAAATCTTCACCTGGACTTATTGTTGACGTGTAACTTTGGCTCAATTTTCACATCTTAA
TATCATTTGTCCTCCGTGTCCGTCCCCTCCCCGGTGTCTCCGTGTGACGTGTCCCAGGGT
CTGGACGTAGACTCCCTGGTCATCGAGCACATCCAGGTGAACAAGGCGCCTAAGATGAGG
CGGCGCACGTACCGCGCTCACGGGCGCATCAACCCGTACATGAGCTCCCCGTGTCACATC
GAGATGATCCTCACGGAGAAGGAGCAGATCGTCCCCAAGCCGGAGGAGGAGGTGGCCCAG
AAGAAGAAGGTGTGTGGGGGAGGGGCCTGTGGGCCGGGGGAGGGGCCTGTGCTGGCGGAT
GACTCACGTGTCCTTCTCTGTTGTGCAGGTTTCTCAGAAGAAGCTGAAGAAGCAGAAGCT
GATGGCCCGCGAGTAAAAACCAATAAAACGAGACTTGTGATGAACAATAACGTCTGATTG
TTGACTGACACTTCATGAGCGATGACATCACTCCCTGTCGGTGATGATTATCGTATTCCC
ATAAATGTGATGAGTATATATTCAGCTACCAGTCTGGTTCCATGGTGACATAAAGAAACA
TGAAGTAGTACCTCTGATTGTTAAATTCACCCATTTCTCTAATTCAGGACGTTTCTTCAA
TCCAAGTGATCAGAATCTGATCCGCGGCTGTCGCTCAAGAGTAGAATAAACAAGTCAATC
GCTGACCGACTTACAGGAAAGTTGTGGACTGTTTTAGTTGCTTTTAATGAACGGAGGGAA
TTAATGTTCCTCTGGAAATTTACCCTGAAGGCTCATTTAGAATATTTAACACCCACAAAT
CTCTCGCTGTGTCTAATTCTAAATATCTACAGTTAATGTCATTTAGCTGACGCGACTTTA
CACTTTAAACCCACGGCCTCTCACGGGGAGCAATTGGGGGTCAGGTGTCTTCCTCAGGGA
CACTTTGACTTAAGACATGGGGGCGGCCGGGACTCGAACCTCCAACCTTCCGGATCACCT
CACGTGGACGGACCAGTGGCTGCAGGGTTTGCCGGTCTGACACCATGGATGATGCAAACG
CTTCCTGTGGAAAAATATACGGTTACACGGGAAAATCCCAGTGGACTCGAGTCCAGACGT
GATATTCTGTGGAGTCACTGCTGACGAGTGTTTTGCCAGAGTTCGATCCAGTGGTGGTCT
ATATTTTTGTAGTGAGTATACTGACTGTTGACGGGACGGAGACGTGAGGACAATGTGTCC
GTCAGTAAGCGAGGATCTATAGTTTTATAGGCCGCCCACGTGACGTGACTTCAGACGGGG
TGAATTTATGAGGGACACTTGGAGCGTTCTGTCACGACGCTGCTGCTACGTATCACCGCG
CTTTAGTTGGCGGGTAAATCCTTGACTTTTCATCCTTGACGCAGAATCCCTGCGTAGCAC
GTAGACACACCGCTGGTTAGATCTCATCCACCCAGAGCGCGGCTGTAAGGGGCCTGAACG
CGTCGCCTCGAGCACAACAGAACCTTTAACGTGATTACGGGTCAGGAGGGAACCCAGTGG
TCTGCAGCGGATGATCTCGTCCACCTTTGGCCCCTGGAGGTGCTCCTATCATGCAGTCGT
CCTTAAGAGGAAGACAAGGAGACAGTGTCTCACTTTACCCCACAGCCACCATTTTAAAAA
TGTCTCTTCAGGCTAATCTTCAGCTAGCACCAATCACATGGTTTAATATGTTATGTGTTC
ATCCACATGTATGACATCAATTCGTTAAAAGAAACTTTACTTTTACATACAAAAACACAT
TTTTGTGAAACCATACTTCCCACAGCATCAGCACCAACGTCTCCGTCCCGCTGAAAACAT
GGTCACATGACCACGTGTCTCACGTTACCCGCCTCGCCCCCCGTGGTGCAAATACCAAAC
CATGCGGGGAAAACACTAGTTTGATAAATCGATTTCATTTCCTTGACTTTAGCGATATGA
ATGTTTCTGAAGACGCTTACACACATTTATGAGAAGGGTGACGTGTTTAAGTTCTCTAGT
AATTAATGGAGTATTTAACTATGATTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1040, 1230..1270, 1496..1630, 1704..1802, 2337..2528, 3233..3289
1001..1040, 1230..1270, 1496..1630, 1704..1802, 2337..2528, 3233..3289
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved