Gasterosteus_aculeatus Locus NACA2
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus NACA2
Gasterosteus_aculeatus
NACA2
scaffold_68
SNORD59, SNORD59
8532..8601, 8826..8895
10536
TAATAGCTCCCCACTTTTAAATTTCATTAAACTCTAATAATATGCCTACATTTTTAATG
AATGCATTATCTCCTTGCTCAAGGATCTTCCTTGTATTAAATTGTTGTGATGGTGTTTGA
TTGTTCTTTTTATATTGTACAGCCATGTGTTGAAAATAAATTTGGTATTTCCACCTTTTC
AAAATATTGTATTCAAGTGACTTTTAACAAGACAAAAACATTAGCAGATTAAGATATTAT
TTTCTAGAATATTAAGCAGTTTGGTTAGTTTGTTAATTTGACAAACCGTTTTTAAATGTA
CACTACATATCTCACTGATAAACAGCTGGGTGATGTTTATATTTTTCAGAAATTAGGGTT
ATAGTTCAGTGTTTTGGGAATTGATGAGATCCTTCTTACCCACAGTCAAACAAGTTTTGT
TGAGGCATCAACTGCACATTGTTAGTAGCTGTCCTGTAAATACTAATCATGTTATTGATG
TTGTACCACATTTTCCACTAATGAATGTATGTAGTATCCCTTTTATCGTTTCAGGCATAG
ATTTCCTCCAGTGTTGCATTGTTATAAATAAAATGGGCACATCTTCTATGATTGTATAAT
ATGGTCACATACAAAACAGAAATATTGGGAAATGTAATGCTGGGTATAAACTAATATTTA
CCCAATATATAATTTAAATGCCCTACAGATGACCAGTTTGTGTGTTACGTTTTCTCACTT
TTGTGTGTCTGCTTTTACTCAAACCAACTGTCAGCTGTTCCGACAGGTGACACTTGACAG
ACGTTCGTAGAAGTATAAAGCAGCATGAAATAAGCACGTTCAAATACTCAAAATGGATTG
CAGTATGGTTGTATAGTAAATGCCGGTTATTTTTTAAAGAATCCCCCGTCTTATTACTAC
TATATTTGTATGTGCGCAGAATCGCTCCGTTACAAAGTAGACTGCGCGTGCCTTCTAAAT
GACCCGGAAGAAGAAGGTTCCAGTCCGAACCGGATATTACCGCGGAACGGAGGTCAGGAG
CTCTCTCTCACAGCCATCTTGGATATAGCGTCCCGAGTCGGTGAGTGTCTCCTCCGATAA
TCCAACATCATCCAACCGTTTTCAGCAATTCCCGTCTGCATTAAACGTTTCACACGTTAG
AGTAAAGTAGTGGCATCCGGCAGGTAGAGATATGTGTCCTCTTTCGTCCCTTGGCTCGCC
GATATAAACCCTGATGTACCGCTGATAACCTGCTCAAAATGGGGTGGCGGCGGGGAGCAT
GATGACTTCCCGCACTGGCAGGCTGTTAAGGCCGCAGTGAGCCGTGGGACAATTGGTGTG
AGGATTGATCGTGCGACAATTTTTAATCTGGATAAACTGGAACGGTAATCCGTGTTAGTC
GTCGTTAGCTTCCACGCCCGTTAAGGGTGTCTGAAGCGGGTTAGCTAGCCGAAGCTAACG
TTAGCCGAACGTTGCTTCAACAGGGAGCTAACGTATAAGCATGGGTTCAGTCACCTGTTC
AACATGCCAAGTCCCGACTGAATGGGCTAACACTCCCCTGCTAACGTCCGTTCACCGGTG
TCACAGGAGTAATCTCGCCTACTTTTGCAACGTTAGCTAATGAAGGTGTAGCTATCTTGA
GCTAATAAACAATTGTTTCGTCATCAGCAACAATGCCCGGCGAAGCAACAGAAACGGTCC
CGGTCATCGAGCAGGAGATGCAGCAGCCTCAAGTGGAGACCGGTTCGTATATATTTCTGC
TTTAACGTGCATGCAACATGCAAATGAAACCACGGGTCCTGGAACTCAAAGAACGGGGGG
AAATGTTCAACAAATGGCCTACCAAGGAAGGTTATTGAGTATGGAAAATATTGCTCGAGT
GGACTTTTTTGTGTTCATGGCGTAGACTCTGCTGGCTGGACACTGAGCTGACGCAACAGG
TGACGGTTATTTTGACTGTCGCCAGCCATTTGTTGAGATATGTCTACCAGTAGTATTTCC
CCACTAAGGGATCGGCAGTGCTGGTAAGGTTTGCCTTAACCTCAAAAGAGTAATCCAGGA
CCCTACTTTTTATTTACACAAACTCACAATGGCGTGTAGTGACTTGCACTGACAACTGGA
TTTAGCACACAATGCATGGTGTTGTTTTCCCTGTGCATAGAAATGCCTTCAACCCATTTG
TAATAGATTAGAACATGCCCATCTCCTATAAAGTATTCAAAGAACGTCAATGCATTTTTA
CATTTTTTTTTTTTACTTTTAAATGTTTTCAAGTAAATTTTAATATTTAGGCTGACACTG
AGACTTTAATAAATGCAGACGTCTTTTGAAAATCATCAGTTGGAATATTATAAATGGTTC
TTGTGTAACCAAAATTAACTGGTATTTCTAAAAATGATCAATGGATTTGCCCATGTTCCT
GTTGATGGCTGATCCTGGGTGCTTTTGAATTTCAAGTTGGGTCGGTAGAGGAAAAAAAAT
AAAGTTTCAAAAAACCCTTAAACCTGTTCAAAAAAGATAAATCTTGTGCTGGTATTGGGA
ACTTTGTGGACTTCAAAGCACGTTGTTAGGAAATACAGGCTCCATAGCAACACGACTGCA
GTGCTGTTCAGATGACCTCAATGATAGGGAAATACTGATACAGCATAAATTTAGGGCTGC
ATTGTTTCTTGCTATCACAATTTTTGTTTTTAAATGAGCCCAACCACCTGCAATGTTGAC
GTTGGCACCCCTGACTGAGCTTCTCTGCGCACCTCGTCTGGACCTTGTTGCGACCTGGGG
GCTGTCGGGTTGTGCCTGCTAAGCCTGTGGGAAGAAATGGTGCCCCCGGAGTGACAGTCA
AAAACCATTACAGCATATTTTTAGAACACTAAATGCCAACAATGATCTTTCATTCTAGAA
TATACGGCCTTTTTAAATAGTTTTTAAAGATTTGGGGTGTTGCGTCTTGGCTCCATAGAC
TTTGCTTTGGAGTATTACAATACACGCGCTGTTCTGCCATATCAAATTAAGGCTTTGGTA
AAATTAAGATTTTTTTCACACAACGTTGTGCCTAGATCACTTGGTGTTTATCTCACATGG
ACACTGCATGTGGGTTTTGGAAGCGGGCTTACTTCTTTCTTCACTGCATCTAGCACCCTT
TTTAAACTTTGGTAAAGCGAGAGCTGGTAACACATTTTAACCTTCACAAACTCAGCGTTT
CTGTCCACACGTGGAGCACAATTTCTTTCTCACTTCACATAGTATCCCTGAAGCTCTTAA
AGCTTGCACAAAATTAGATGTGCTCCCCAACAATTACTCTGATTGCCCTTCCCCTGTTAC
TCCTGTTACTTTTCCTTAATCAGCTGGAGTATTCAATTCTTCTGCTCCTCCTGAGATGGC
CATTCCTGTGAGCAAAGCTATCCCACTGGAGATTCCTCCAGAAACCTCTGTTCCTGCTGA
AGCGATGGGTTCCCCAAAAGATGCTAGCATTCAGAGTACTGATGATCAAGCAAATGGTGT
TGCTGCAACTCAAGAAAAGGCAGAGTGTACCAAAGAGACCAGATTGGCGTCCACACTTGA
GCCACAACAGAAGACTGCTGAACAAGCCGGGTCTTCAGCTAACCCACCAGGTCCTGAAGA
GGCTCCGCCTTCTGCTAAGATGCCTGTTGTCTCCGTAGAAGGGCCAAATGCTGCAGGTTC
AACTGTAGAGGTACAAGGTCAGGAGCCAGTTGTTGTTGTTGCTTCTGCTGAAGAGTCGGC
CGGCCAAGAGGTGGAGCAGATTTTGGTTGAAGCAAATGTCCATGAGGCCAGTGCAGTGGC
AGCAGGAATTCTCGATGATCCAAAAGCAATCCCTACTGAAGTCCTTGCCAACACCAAAGA
CGTGAAGGCAACTGAGGCCCCAGTGACTGAGGTAGAAGAGTCGAGGAATGTGTTTGTGGA
TGCAGCTGAAGATAAAGTGTTACCCATTCAAATGAATGTCAATTTGACCACTGAAAATGA
AGATCTTGCTAAGAAAGAAGCTGTAACGCTTCTCCCCAAGGCTGTTCAGTCAAAGGAGTC
CTCCAAACGTGAAGGACCCCCTCATTCCACTTGCCACCTGTCAGGTTGGTCTGTCCAGTT
AAGAAAGCACTCCCCTCCCTACCTTCATAATTGAGCGTTTTTTGATTTGGTTAGGATTTT
TTTTTTTACTGCGGCTTTACATGAGCGATAACAGTTCAATGGACAAAGGTTTATAATGTC
TTTTTCCTGCCATGGTTGTCTCCCATCTCTTTTTAGATAAGTGCATTTTAGTCTTTTTTT
GTTTCCCTTTGGTGGTCAGTCAGTCCTACCTTGAAGCATCAGTTTTGTGTGTGTATCATG
TTAAATGTGATATGCACTGAAAATAGGATTGTCCCTTGTCTTGCATTGCATCGTGACTAA
ATACAGTGAGTTTCTTCTTGGAAACAAATGGCATCAATGGTGTATTTTGATTGCGGTTTT
GCATCAAACTCTAAAGTTGGACAGGTGTTTTCCTAACCCTAAGCAAGGAGATTGCGTCTT
GGTTTGCTATCATTTAACCCGCATGAGTAAGATCTCAGTTTTTCCTGTCAGTAAATTTAA
AGATTTGATTTTTCTATTCAGCTACTCCTCCTGCCGCAGGGTCCTCCCAGAAACCTCAGG
CAGCTTCTGGCCCTGCAAAGCCCAAAGGCAAAGATGCCAAGAGTGCGCAGGGTTTTTCTG
CCCCGAAGGCTGTACCTGGCAGAAGGAAACGCTCCTCTATGTCTGCCTCTTCCTCCTCCC
CCACCTCACCAAAATCCACTTCGTCCACCACCCCCCTTTCAGCTGTGCCATCTCCCCTAG
CTACCTCACCTGGAAGCTCTTCTACTAATCAGGCAAAACGTTTCACCCCAAAAATTGTCA
AGGCGGGCAAACAAGGAAAAGCTAAGAAAGGAGAAGCATTTGTGTCCGTTCCGTCCCCTG
TGGCGTGTAAGGAGACCCCAGCAATCGAAAAAACGGTGGAGGTGATGCAGTTTGCAGCCA
CAGCTGCTTGTAAAGTTACCTCAAAGCCTGCAGTGGCCACTCCATTTTTAGATACTCTTG
CATCTAGCCCCCCCACACCAGTTGAGTTTAAGACCGCTCCATCAAAATCTGGCACTGTAA
TTGTTGCTGCTGATGATGACCTCCCTCCACTTATCGCACCGGAGAAGCCAGAACCTGCAC
CCCCCGTAGAAGCTACAAAGGTTGTTAAACCAGCTCATAAGGGATCCCCGGCCCAAATCA
AAGCTGTTAAAGAGGTCCCATCAAGCAAAAACTCTAGTGTTGAGGCTTCTGATTCAACTG
CTGTAGCTAAACCAGCCACAGAGGCTAAACCTGCTCCCCTCGATGCAGCTAAACCAGCCC
CTGCTAAGGGCGTTAAACCAGCCACAGAGGCTAAACCTGCTCCTGTCAAGGCTGCTAAAC
CAGCCACAGAGGCTAAACCTGCTCCCCTCGATGCAGCTAAACCAGCTCCTGTCAAGGCTG
CTAAACCAGCCACAGAGGCTAAACCTGCTCCCCTCGATGCAGCTAAACCAGCCCCTGCTA
AGGCCCCTAAACCAGCCGCAGAGGCTAAGCCTGCTCCTGTCAAGGCTGCTAAACCAGCCA
CAGAGACTAAACCTGCTCCCCTCGATTCAGCTAAACCAGCCACAGAGGCTAAACCAGCCC
CTGCTAAGGCCCCTAAACCAGCCGCAGAGGCTAAACCTGCTCCCGTCAAGGCCGCTAAAC
ATCCCCTTGATGCAGATAAGCCGTCCACAGAGGCTAAACCTGCACCCGTTGATGCAGCTA
AACCAGCCGCAGAGTCTAAACCAGCCCCTGCTAAGGCTCCTAAACCAGCCGCAGAGGCTA
AACCAGCCCCTGCTAAGGCTCCTAAAGCAGAGGCTAAATCAGCTCCCTTCGATGCAGCTA
AACCAGCCCCTGTTGATGTAGCTAAACCGGCCCCTGTTAAGGCTAGTAAACCAACCACAG
AGGCTAAACCCACCCCCATTAACGCTAGTAAATCAGCCGCAGAGGCTAAGCCTGCTCCCG
TCGATGTGGCTAAACCAGCCACAGAGCCTAAACCAGCCTCTGCTAAGGCTAGTAAGCCAG
CTGCAGAGGCTAAACCTGCTCCCATCAAGGCTGCCAAACCTGCGGCAGAGGCTATACCCG
CTCCTGACGATGCAGCTAAACCAGCCGCAGAGGCTAAACCTGCACCCGTCAAGGCCCCTA
AACCAGCGACTGTGGCTAAACCAGCTCCTGTCGATGCACCTAAACCTGCTCCCGCTAAGG
CTAATAAGCCAGCCGCAGAGGCTAAACCCGCTCCTGTTAAAGCTGCTAAACCAGCCACAG
ATGCTAAACCAGCCCCTGTTAAGGCTAGTAAACCAGCCACGGAGGCTAAACCCGCTCCTG
TCGAGGTTGCTAAACCCGCTCCTGTTGAGGCTGCTAAACCAGCCGCACAGTCTAAAACCA
CTCCTGTCGAGGTGGCAAAACCAGTGACCGAGGCTAAAACAGTCCCTGTCAAAGCTTCAA
ACCCAGCCGCAGAGGCTAAACCTGCCCCTGTTGAGACTGCTAAGCTGGGCCCTGAGGTTA
AGGTGGCACCTGCTGAGGCTTCATCTGCTCCTGTAAAATCCTCTCCAGTTAAGCCGGCTT
TTCATGCCCCAGCGCCCCATAAACTCACATTTGCTGAGGCAGTTGCAAAACCGATCCCAG
TTAAACCAGAGGGTGATTTAATAGGTAAGACTCCTACAGAACCCATCTCTTCACCCAAAC
CTGCCCCCACACCCGCTAAAACCCCGGTCAAGGTGGAGCCTGTGATCAAGAACGACAAGG
GTATTTTCTTTTCTCTCCTTTGTGCCATCTGTGTTTCCAACTACCTCTCTGTTCTGTTAA
TGGCTCAGATTCTGTTGTCTTCAAAGTTATGTTGATGGAGGAACATTCGCTTTCTTTTCC
ATTTTATTTTATCCTTTCTTGAGGATGCTACGTAGTTGCTGACAAGGAGGCCTCTTGTTG
TAAATGGTAGTTGTGTTGCATACTCGACATGTGGCAAATCTGATTTGTTATTGGTTAGGA
GGGTTAGTTACTCTTTGAATCTAGCTGCTGAAACTACCTTTTGCAACACCGTTGCAGATT
TAAATGAACGTTTCAAATTATTTTAGGTGGGTGTCTGGTCATCCGGGATGAGAAATTGTT
TTTAAACCCTATTAACCTGCCTTATTTTCAATCCCCAGATTTAGGACTTTCAAATATACA
CACGTGTAATAGTTGCCTGGTTGTGACTAAATTATTTGATTCTTTTAAGGATCTGGTACA
GAGTCGGACAGCGATGACTCGGTCCCTGACCTGGAGGAACAGGATTCTGCACAAACACAG
ACACAGCAAGCTCAGGTTAGAGAAGAGTCTGGTCCTAAGAAATGTCCACATTTGTCCTTT
ACTCTTCAGTGATGATTAACAGACTTTCGTTCATCTGAGCATACTGAAGCCAACCTTTCT
GTGCTGAGAAGAGCGTTTACAAAATTACTTGAATATGTCAAGCTCACCATATTCCTTTGC
GTGCATTTACTTTTTTGACCTAAAATATTGTCTGTCTCTTGCAGCTTGCTGCTGCTGCAG
AAATAGACGAGGAACCAGTCAGCAAAGCCAAACAGAGCCGCAGTGAAAAGAAGGCACGAA
AGGTAATGCGGGATCAGTGTTTAAAGAATGTAATGGGCCCTTTTCTACTTCCTCTGTGGC
GCTCGCAGTTGGCCACATTTATGAAATGACTTGTTTCTTCCAGGCAATGTCCAAGCTTGG
TCTCAGGCAGGTAACAGGGGTCACCAGGGTCACCATTCGCAAGTCAAAGAATATCTTGTT
TGTAATTACCAAACCAGACGTCTACAAGAGCCCTGCATCAGACACATACATAGTCTTCGG
TGAAGCAAAGGTACGTATCAGTTGTCAATATTATCCACCTTTCTCTTAATCCCTTGTAGA
GCTGATTGCTCATGTCATAGGATCCGTTCCAGTCTTATCTTGTATAGCTACAGATCACTG
ATTGAACCGTCCAAAGAGATGATACCAAAATCTTTTGGCTCAAAATATTCTGCTAAATAA
CGTCTCAATCTCCTTTTTATTCTGCGTTCTCTAGATCGAAGATCTTTCCCAGCAAGCCCA
GCTGGCTGCAGCAGAAAAATTCAAGGTACAGGGAGAAGCTGTATCAAACATACAGGAAAA
CACACAGACGCCAACAGTACAGGAGGAAAGCGAAGAAGAAGAGGTAAGATGAAGTTTTAT
TCAAGTGAAGATGGACTCTACATATGAATAAACATTTTTTGTTTTAACATGAACTTTTAA
CAAACTATTGCCCCGTGTCATTATAGGTGGATGAGACCGGCGTTGAGGTCAAGGACATCG
AACTCGTTATGTCACAAGCCAACGTGTCGCGAGCGAAGGCTGTACGCGCCCTGAAAAACA
ACAACAACGACATTGTCAATGCTATTATGGTAAGATTTCAAAATGGGTTTTGAATGGTCA
TAAAATTGCTTTGAGTATTTATCAATAAAGCCATTTAAATGTCCATTTTAGATAGATAAA
TGTATGGGGAGCTCTTCAGTGATGATTAACAAACTTTCGTTCTTCTGAGTTTACTGAAGC
CAATATTTCTGTCCTGAGAAGAGTCTCTTTGTAGTGAGGAAAAGAAGTGAATGTGAAGAC
GTAATAGATAATAAATCCTCTTTTGTTCCCTCTTGCAGGAGTTGACGATGTAATGGGACC
CTCGCAACAAAGGGTTGAAGAAAGGTTGCTGATGTGAGCTCATTTATACAATTTTCATCA
ATAAATCATCAATCAATAAAGCCATTTAAATGTCCATTTTAGATAGATGATCTGTGTATG
GGGAGCTCTTCAGTGATGATTAACAAACTTTCGTTCTTCTGAGTTTACTGAAGCCAACAT
TTCTATCCTGAGAAGAGTCTCCCTTTGTAGTGCGGAAAAGAAGTGAATGTGAACACATGT
AATAGATAATAATTCCTCTTTTGTTCCTTCTTGCAGGAGGTGACGATGTAATGGGACCCT
CGCAACAAAGGGTTGAAGAAAGGTTGCTGATTTAAGCTCATTTATACAATTTATACCCAA
GGTGGAAATAAAGTTGTGGATGATAAATTGAAATTTTTAGTTTTGCACATCATTGGAAAA
TGGGTGGAATTTTTGTTGTGGTCTGGTTGCATAAATGATGGTTGACCTGTTTTTTTTGTT
CATGGATTTCCGTTTTTCTTCTCATAAATGACTATGGTTCACAAAGAGCTGATCCAATCC
AGCGCCACTTAATTATATATCTTTGAGATGCAATTTATCTGAATTCTGGCCGGATGCATC
AACTATAATTCTAGAGGTTGCAGGCCAGTAAAAGTGATATTAAGATGAGAAATACCTATG
GAGTATATTATCTTGTGTTATTTAAAGTGTTTAATATTATTTTTTTAAATGGATAATAGA
GCAGTTTCACTGACTGGGTCCTGCTCTTGGTTTATCTCCATCACACACAGGAGGACCACC
TGATGCACACATAATCCCACCAATGACTTATTCCACTGCCAAAGATGTGCAGCAATGTGC
CAATAAAGAACGCTGCAAGTGGGGAACATAAGGAGAAAAATATTTTTAAATCCTAAGTGT
TTTGAGTAGAAGTACTTTTGTACACTTTACCATTAAGAACCTGCTTGTTTGCATTACTTA
TGAAGAAGGCAGCAGTAAACACACCAATAAATAAGATATTCCTTTATTAGTCCCGCAATG
GGGAAATTCAAAGGATAGTGGCACAAACTGGACCGTGCACACAAGATACACAGTAAAAAA
AACAAGAGCAGCAGCAAATGCCAAGGCTCAACTTGGCCTATCAACAGCTGCTATAATTAT
GGTACATATTTAAAAGTAGGTAATGTGGACAAATCCTTTCACTTATGTGTTTGAGTTGTT
TCACCCCTTGGATATTATATAAGACAATTAGTCCAATATACAACACATTCTGAATAAATC
CTTGCGGGTGGAAAAATTAAAACTCCAAGCTCTATCCTATATGTGATAAAGGATACCTTA
AGGGGATATTTACATTCATACATACAACATAGGTTGTCAACTATTCACTGTATTCATGAA
GATCGACATTTCTGACCACTTATTGGATCTCCCTTTGTAAAATTGTTGATTGGGTCGCAT
TGGCCCATTATATCGTTTTTGTAAATACTTACTCAGACAGAAAATGATTAGATTCACAAA
TTGGTTAATTCGCAATGCATCTATTTGTTCTAATGTGATGGTTAATTTGTGGGTTTTCAC
TCAAATATTGACCAAATGATTTATTCAGAAATTATTTGGAATATTATTGTGGCAATGTAT
GTACGTTATATATACACGAGCATATACACATATATATATATAGATCAACCCATCTTTATG
GCTCTTATTTCACTTTCTTAATGAACTTCATATTTATGTCTCTGCGTGTCGTAATTCGAA
AGGGGTTCTTTTGATATTTTTATTAAATATGCTTGTAAAGATAAACAGACGTAAAATAAT
TGATTCGCCCCACACCAGATTACACTCCCCTCCCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 1647..1721, 3323..4063, 7249..7334, 7544..7621, 7723..7869, 8074..8202, 8306..8428, 8678..8732, 8976..9536
1652..1721, 3323..4063, 7249..7334, 7544..7621, 7723..7869, 8074..8202, 8306..8428, 8678..8689
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved