Gasterosteus_aculeatus Locus RPS7
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPS7
Gasterosteus_aculeatus
RPS7
groupXVIII
SNORA73, SNORA73, SNORA73, SNORA73
2300..2518, 2958..3176, 4096..4314, 5060..5278
6550
CTGATTATTTTGGATCTGTACCGATGCTCCATTTTCATGATGCTTTTTCTACACATTTG
TTAGACTAAAACCCAAAATCAAAATGTGACATTTTTCGCCTTCCTTGTTTGCAGCAGCGC
AGCAGAGCACATATTAGCAGCCTGTACAAACCACGGGGAGGTTTTCGATGAATTTGTCAA
TGTGTCAGCCGTGTTTTAGGTGAGTTAATGCTGCTTAGCAACGCCCACCACACGGCGAGT
GTTTTGATGGAAGAAATTCAATATCAGTCAAATAAAAGAGGCCAAGGAGGCGTTAAAACA
CGAGCTATCCGAATGGAGTCTGGCGTCTCTCGCTAAATAGGAAACGCACCTTGAAGGGAT
CAATGGCTTTCGGTGTTCTGAAAAACACACGTGCTGACAGTGCGGTGTAAACGGTCTCAC
CATGACGTGTACACGCCGGGTTTGAATCCTTTCTGCACGGCGTAGAAGAACTTTCCCTTC
GCCATGTCGTCGGCGGCGCTGCAGGCGGTCCTGCGTAATGTCACTGCTCTGAAAAGACCA
GTCAGTCTGAGCATCACGACGCGGATGTGGCTAACATCGTGGCGTTAACTCAGAACACTA
TTGTATACATTTACATCTGACTTGTCAGTGGGTGTTTTGATATAAAACCCTTTAAATGTA
GCTAATAGCTAGGTTAGCTAATGTTAGCTGGTTTCCCTGCCTTGAATCTGAAAAATAAAT
AGGCAAACGCTATTTTTAAGTATTCCGAATAGTTTTAACAACAGTATAACCTCTGCTGGA
GTCCGGAGTTAAGCGTTTGATTAAAGCGTGGTATGTCCAGCAAAAAAGAAATGACCAATA
AAGTGAACAGCAATGTTGACAACGACAGTCACCGGTCAACACAAACTCTCGCGATGTTCT
TATCCCTCAGAGCGTGAACTCAAAGAGCTCTCGCGATACTAAAATGCGACTTCCGTATTG
GATTAAACCAACTCTCGCGATGGTCCGGCCTCTTCCTTGGCCGTCGTTGACAGAGGTTAG
TCGTGCTACTTTTCAGAGGACTGGCTTTGCTACCCTAAAATGTGCTTTAATGTCGTTTTA
TCTTTACATAAACCCTTCGTAACGCTTCTCGAGACTCTGATACCTTAGATTATGCCATCT
GTGGCGACGGATGGCTGTTTTATTTGACCAAATTAAGCGTAGTAGAGAAGCTCTGGTGAC
GGTGTTCTTGTAATGGGGAGTAACGTTTATTAGCAGGCCGTACATGTGTTCGGTTACTAG
CTACGCTCTCTCGGAGAAGGACGTAAATGTTCATGTAAAGCTTTTAAATGCGTTGTTTAA
TGTTAAATTGGTTACTTGTGTATGCTAGTAACTGAACTCTTAAGCCTAAAGGTAGCCGGG
GTAAACTGCAGTTATTTAAGCTAGCTAATGCTCCCTTTCAGCTAGCCGTAGCTTATCCTA
GTTAACCTGCTGAGAGTATAGTTAATATTTAGATTTATCTTTTTGTATCACCTCGTACAC
ATTTTTACCCTTTACTGTTACCGATGTCGACTATGCACGCTAGTTATCCCGGTTAGCATT
GAGCTGCCTCTTAGCCCACAGTACATGCTGGGTTAGCTAGCTCCTCCAGGATTCATGTGA
GATCTAACGTTAGCATGTGAAGATGTAGAATCCGAGGCTCACTGTGTGTAAACCTGCATT
TCTTTTCTCCTTGCAGAGACAACGGCCATGTTCAGTACTAGCGCCAAAATAGTGAAGCCT
AATGGCGAAAAGCCAGACGAGTTTGAGTCCGGGATCTCTCAGGTAAGACCTTTTTGAGTT
GATTTAACCGCGATCTGTATCGTAGGTCTTCAGGCTGAATGTGTGAGAACATGACGAACC
ACAGATTATTTGACATGATATTTTAAAAGCCTAGATCAGAATGAAGTGGGTTTTTTTTAG
ATACAGCAAAAGTATAACGTTACTTACGTGCAGAAATCCGCGATTGGGAGAAGTCTATAA
TTGAGAGAAAACGACACGTGTTCAGGAATTAATCGTATGTGTTGGTTTCTGAATATCAAC
AAAGCAGCTTCTGCTTCGTCACAATAGAAACTGCTTTTGTCTTTAATACCTCAGAGTGGA
TTTAAATCATCAGTGCTGTGTAAAATAAACTTTTCTCCCTTCAGGCTCTACTCGAGCTGG
AGATGAACTCCGACCTTAAGGCTCAGCTGAGAGAGCTGAACATCACTGCTGCAAAGGTAG
GACCACTTTTAAATATACGTCTGTTATGAGTTAAAGAGCTACCTGTTGTAAGCACCATAG
TGCTGGTTCCGCAGATCAACCCGACGTGGTCATCCAGCGAGGTCACTCTCCTGGCTCTGT
CCTGGTGGCGTTATGGGAGCGTAGCGTTCAGCTGAGACGTACAATCCCGTTCCACAGCGT
CGGAGACAAAGCTCTGACCCCGGCCTCCGGTCGGTGGGGACGAGTGTCCTGCATATTCCT
ACAACTTCCCAGAGTCCTTTGGGCCGTGACTGGGGGGCTAAACCATGCAGTGCACATTCT
TTCATGTCAGGGCATTAAAAGTTTTGGTATTTTACTGCAGTAATCTGAATTGTCATTCTC
TGTAGCTTGTTAATCCTGAAACCTGGGTTTGAAGTAGTGGGGCTCTTGCAAAGCTTTTGT
CATTTTTTATTAAATGATTTCTTTTCCATTTTTACTTTAAAGGAAATCGAGGTTGGTGGC
AGCAGGAAAGCCATCATCATCTTCGTTCCTGTTCCTCAGCTGAAGTCCTTCCAGAAGATT
CAGGTGCGCCTGGTGAGGGAGCTGGAGAAGAAGTTCAGCGGAAAGCACGTCGTCTTCATT
GCACAGGTGAGAAGGATGATGCAGCTGCTTCAGATACTGTAGCGGTTTTGGGAGAGTCTC
ACAAGCCTACATGTCTGGTGACCTCCTTAGGGGTGTGCTGAATCAATGCTGGTTGTCTTT
AGCGTTTCACCGGTTGTCCCGACGTGGTCATCCAGCGAGGTCACTCTCCTGGCTCTGTCC
TGGTGGCGTTATGGGAGCGTAGCGCTCAGCTGAGACGTACAATCCCGTTCCACAGCGTCG
GAGACAAAGCTCTGACCCCGGCCTCCGGTCGGTGGGGACGGGCGTCCTGCATATTCCTAC
ATCTTCCCAGAGTCCTTTGGGCCGTGACTGGGGGGCTAAACCATGCAGTGCACATTGTCT
CACCTGTCAGGGTTTGACTGATGTCACATCAATGTCGGATATCAATGGTTTACTAAAGTT
TGATCAATACAATTTTAGTCAAAAACAGTTTTCTGTCTGCAAAACTTTATATATTTACGA
GTTTTTCTGTTGAAATGTATTTTATGCAGAAAGAAGCAAGCAGTCTTTGACGCTGTCGAG
TAAAGCTAAGAGCATGAATATCAGCAGGTTATATCAGTCTTACCCTGCTGCTTTTGTTTC
CGAAACTATTTCCCTCCTTGGATTATTTCAGTTAGTGTTTGTGAATCTGATTTGGTGATT
AATGAAGAGCCTGTTGTATTTCCAGAGGAGGATTCTGCCCAAACCCACCCGGAAAAGCCG
CATTAAGAATAAGCAGAAGCGTCCCAGAAGGTGAGTAGCGTTTGATTCACATCACCAATA
ATAATGAGTGTTAGGTGTTTGTCTCGTTCATGTTAATAGAATTTATATATAAATATTCCT
GTCCCTGGTATTTACTGCCATTTTGAACTTTTACAGGATTACACATTCAGGAACTGCTGT
TGACTTAAATGAACACTAATGGTCGTATGACATCTTATTGTAGGGTCATAATTAATATGC
AAACCGGCATCATGATACATGAGCAGATTCTTTTTAAAGCCAAAAATATCAATGTATCAA
ATTTGATTAACCATTTGGTTTGTTGACCGTTGTAAGACGTGTTTTTTAAGGTTGAAGATG
CTTAAATTCACAAAAAATGTTAAATCCATAGAGCTTCATCTGATGTTTAATTATCCATTC
TTGGGACATTTGATACATTTGTAAAATAATTGTTGAATCGCCCCAAAAAATTGGGAATAC
AATTCTTGTTCTTTAAAATAAACATTGTTGTACTTAAACGTGATATAAACTAATAGCAAA
AAGTGGTATTGTTGTCCCGACGTGGTCATCCAGCGAGGTCACTCTCCTGGCTCTGTCCTG
GTGGCGTTATGGGAGCGTAGCGCTCAGCTGAGACGTACAATCCCGTTCCACAGCGTCGGA
GACAAAGCTCTGACCCCGGCCTCCGGTCGGTGGGGACGAGCGTCCTGCATATTCCTACAT
CTTCCCAGAGTCCTTTGGGCCGTGACTGGGGGGCTAAACCATGCAGTGCACAACACCTGT
CTACAGAGGAGTCCTCAAGACAGAGACTCCAAATTTTTATTAACCGTTTTTACCAAATGA
CACAGGTTGAGACTTTTAATGACAAATCATATTTCTCCTAACATAACCTGAATTGATTAG
ATAACTGCTGCCACTGTTGTATTTGATTTAATCTGCCGATAATATTCCAATAAATTTGTG
GCTGTCAGTCAAAACTTTTAAAAACCTGATGTGTCTTCAAATGTTCTTTCAACTGCAAGA
AATGAGAGTAGTTATAAATATCTTTCAGAATATTATCCATTACTGGACTAATGGCGCCAA
ACCAGACACATGAGCTCTGTTGTGTATTAACGTGCTTTTGATTCTCAGCCGCACGCTGAC
CTCGGTGCACAACGCCATCTTGGAAGACCTGGTGTTCCCCAGCGAGATCGTTGGAAAGAG
AATCCGGGTGAAGATGGACTGCAGCCGGCTCATCAAGGTCCACCTGGACAAGGCTCAGCA
GAACAACGTGGAACACAAAGTGAGTCATTTATCAATTGCATCTGATTTTTATTCTGCATC
AGTGCATTTTAATCTACCATGTAACATCTGAAAATAGGGGGAAACTGATCGAAACCGGTC
AATGGGTCTGTTTTCTTTTAAACAGCTGTTTAAAAAAAGAATATGAATAACTTTCTAGAT
TCCTGCTCATGGAGACTTGGAGAGGTTTTTTAGATTAATCTACAAATGAGTGGCGTTTGA
AGCATTAGCACACTATGAACCCGACGTGGTCATCCAGCGAGGTCACTCTCCTGGCTCTGT
CCTGGTGGCGTTATGGGAGCGTAGCGCTCAGCTGAGACGTACAATCCCGTTCCACAGCGT
CGGAGACAAAGCTCTGACCCTGGCCTCCGGTCGGTGGGGACGGGCGTCCTGCATATTCCT
ACAACTTCCCAGAGTCCTTTGGGCCGTGACTGGGGGGCTAAACCATGCAGTGCACAACCT
CCGCCTTAAATCTTAAAGTTTAAAATGTATCTCGCATTGTTTGTGAACCTTTACTGGGCT
CAGCTTCTTCAATGAAAACAAAATCTTAAAGTTCACACAAACTAGAGAAAAGGTCCCCAA
CCTATTCACGTGATGATTCAAAATTGTTTTTCATCTTCCAGGTGGAGACTTTCACTGGTG
TCTACAAGAAACTCACAGGCAAAGACGTCGTTTTCGAATTCCCCGAATTCCAGCTCTAAA
TGCAGCCAACAAAATAAATTTGTTTACTGTCACAATGGTTTGTTTTTGTCATTTTGTGGT
TTTATTCTGCAGTTGGTGTTTTTTGGGGTGAAGAACCTGGACTATAAATTATGTAAAACT
TTTACTGAAGTCCTTAATATTAAAACCAAACTTGTCAGCTGGCACTCAACCAATTTATGT
ATTTAAGAGAAAAAAGCCACAGCAGATGTGTACCAATTAAAACATTTAACAAGTAAATGT
CTCTACAGTTGGCAGTGCATGTTAATAGGTTAAAGCTCTTTATAGAGCCAGATTTCATAT
TCTAGACCAATACGTGATCTCACCTGTTCCCTTAACTTTTCTGTAAAATATTTTTATTTC
ATTGAAGTATAGAGGGCGCCATTCCTCCCACTTTGTATCACGCTGCTCTTGATTTTCAGA
GCTAGTGTCATGTCATAAACTGCATTATACACAGGAAGCTCAACAGGAATCTGAACCTAT
GATACATACCATGTGATTTTTGCCTTTCTCTTTGCAGATCTGACTATTCTTTAATTACGT
TTTTCTACCTAATCTTTTTCGTATACATGTTTTTGGCATGACTGTTGAATTTAACAAATT
TGACTTTCTTTCCATGACATTCTTTGTTGCATGTTTTGGCTGTTTTATCAGGACCGTCGA
CCAAACATTTAGACTTTTTCAAAACATTTTTCGACCTTAGTTTTTTTTTTTTTTTTTCCA
TATTGATCGAATATATTTGCACTTATTTAGAAACATTTTTTTTCAAAGCCTATTGCCCAA
ACTATGTTTTGACACTGTTTTGTCATTGTATTCATCGACCGAATATATTTGAATTTTGTA
TTTTTGGGAGAAAAAAACTAGCTAATGTTCCCAACTTTTATTCTTTGATAACATATTTGA
CATTTTTTATAAAATATTTGACTTTTTTTTATATTGACTTTTTTCAAAACATTTTTCAAC
CTAATATTTTATTTTTTTTCTCTGACATTCATTGATCGAAAATATTTTGACCACATTATT
TGACTTATATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1696..1781, 2144..2215, 2682..2825, 3505..3569, 4668..4818, 5441..5550
1707..1781, 2144..2215, 2682..2825, 3505..3569, 4668..4818, 5441..5515
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved