Gasterosteus_aculeatus Locus ENSGACG00000008580
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus ENSGACG00000008580
Gasterosteus_aculeatus
ENSGACG00000008580
groupXVII
SNORA63, SNORA63
1295..1424, 1659..1788
3012
TATAACAATCATTATACAAAATAAAATGGGGATTGACAGACGTATTCATATGAGTACAA
GCACATTTTGGGGCAAAAGGTAATGAAATGACATATAAAGCTTCAAAAGAGGCCACAAAA
AAAGCTAATATCACAGTCAGATCCAGTCAACGAGGAGCTTTGGGCGTTAGCCATAATAAA
AATATTTTTAAAAACATTTTATTTATTTATTTATTGTAAATGACCTCTCGCGGCCCGCAT
GCAGTACCTTCGCGGCCCACACTTTGGGAATCGCTGCTTCAAAGCATTCCAACAACTACA
CAGCACGGTGCACACTCCGCACCAGCCGCTGGCGGTATTGTGCCAATTCATTCTTTGCCA
ACCGCCTTCGAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGTAGTGGGGCGTTG
GTTGTAGTGGAATTCATTGTATTGGTGATAGTGTGGCGCAGAAGTGATTGACACAGCGAG
CATCAAATGGTTGACCAGCTGACGCCCGCAGCTCCGTCGTGAGTGGACAGTTGGTTCTAA
TATAAATTCGTCTTGTGGTTCTCTTCCTGTCTCCTTCGCCAACCTCAGCTCCTGAAAGTA
AGTACTGTGCGTCACGCTTTCAGTAATAAAGACGAGGAAACTAAAACGTAGTGTAATAAT
GCAATGTTAGATGTATGGCTTAATGAGATAACTGCGTACAGCATTTAACGCTGAATGAAG
GTTGTTTAGTACACGGTGGTGGGACTAGTCAGCTGTCGACCTCATGGCGGGTGTAACCTT
ATCGTTTGTACTGTTACTAATGTGCTTTAGTTGTATTAACGAGTTTGATCTGTGTATACA
GGTTCTCGCTGGTCTTTACAATCAGCTTTCAAGCGATTCTTTGAAGCACTGCAAATATGC
CCACGAAACACGAGGCCACGTGGAGCTCCCAACTTGCTACTTAGCTAACATTCATTGTAA
GTAAGGCTCATCTGACTCCTAGTTATTGTGAAACGCAAGCTAATATAACGTTTTATGCTG
CAATTGTATGAAATAATTCATAACGTTATATCTTAACATTGTGTTCCCCTCTTATTTGTA
GCAACTTTTGGATGACTATCCAAAATGCTTCATTGTGGGCGCAGACAACGTGGGCTCCAA
GCAGATGCAGACCATCCGCCTGTCTCTGCGTGGGAAGGCTGTGGTGCTGATGGGTAAAAA
CACCATGATGCGCAAAGCCATTCGCGGCCACCTGGAGAACAATGCTGCCCTGGAGAAGTG
AGTCTTTTACTTGAGCTATTTGACATGTTTTTGTCAAGCAGGATAAGTTACAATGCAGTT
AGTGGAGTACTGCTTTGTCGTTCCCCCTGCACACAATAACCTGTTTCCACGCTATACCTG
TCAGTCAGCATCCCTAGACTGCCAGGCACGTACGGTTTCAGACAATTTACACGATATGTA
TTTGTAGATATGATTATCTGCACACCTATTGTAACCGTCAATTCCATGATTTGATCGGCT
TCTGCCTCACATTAAAGGAAACGTGGGCTTTGTCTTCACAAAGGAGGATCTGGCTGAGGT
CCGGGACATGCTGTTGAACAACAAGGTAATGCAAGTGAAAATCTCAATACCGCTCCTGAT
CAACCATGATGTTTGAGTAAAAGATCCCACATTTTTATAAAGCAGGATAAGTTACAATGC
AGCTTGTGAAGTACTGCTTTGTCGTTCCCCCTGCAAACAATAACCTGTTTCCACGCTATA
CCTGTCAGTCAGCATCCCTAGACTGCCAGGCACGTACGGTTTCAGACACCAATTAAACTA
ACTCTTTATGTTGAGTCACAGGTAACTATGTTAAAACCTACCATTGGGATTCCTATTTGG
CCCCAGTCTCATATTAAACTGTCTCCCTCTAAAAACCCAGGTACCTGCAGCTTTCATGCT
AGAGCAAACTCCACTTGTCATGTGAATGTGCCATCCCAGAAAACCGTCCTCCTCCGGACT
CGACATCAGAGGCTTTCTGCATGCAAAGTTCCTGGAGGTGAGATTCTGTTAAATGATTAC
CTTTTGCTCAATGTCCAACATTGCTTGCCAGCAGTGCATTGAAACTAACCATTGTGTATT
TTTTAGGGTGTGAGGAACCTCAGTGTTTGTCTGCCGATTTGCTGCCCCACTCCGGATCAA
TGGCTGAGAGTTCTGGCTGTTACTGATAACTCCTTCCTGGCAGACCAGGTATGCTTGTTA
AATCATTGGCTGTCCCTTTTAGTTGGCATGAATGTTACTTGAGTGTAAATGGGGAAAACT
TAAAATATACTTTATTTCCTTACAGGTAAAGGCCTTCCTGGTAGACCAGACTATTTTAGA
TGCTGCATTAACATCTGGAGCTGCTCAGAAATAGTCTGAGGAATTTCCCGACCACATGGT
GGTTTGGCTATTCGACTGTCAAAGAAACCAGATTTGAGCCAAACTATGATTCAATAAAAT
CTCAAATACCCCAGTTTTTGTGTCTTGTGATTTTTATTTTCCTTCGCTCAGGATGGACTT
GAGTCTCGTTTTAAGCCCATAATGAGTGCATGAGTTTTTGTCCATAGGAGTGAATGTGAA
ATTATCCTTAATTTGAACGGAAATTTAAAAAAAATGCTTTATTTGCCTCCAGTGGTTAAC
TAACCCATGCTTGTTCAGAGGTTTAATGATTAATGCTGATTAATATTGCATACCAATTAC
TGTTGCGCCACACTAAAATGGAATCAAGCTTCACTTACCCTGAAGTGACATGGCTATCCA
CATTAAAATTGACTGAGTTATTGCATCTGGCAACATATAGTAGGAATCACCATTTTAACC
TTTTTGCAAAGTTTGAAGGACTAAAGGTTTAGAGGATATTTTCTCACCCATCTGATTTCT
TTAATGAGTCCATACCTTTGGAAATCATACATTGTATGGAATTAAGTCAAATGATAGTAT
TTCAATGTCTGACATTGTTTTCTACTGCAAAGTAGTCCTTTTGTGTTCCGCAGGACTAAA
TCTGAACCACCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1081..1256, 1497..1589, 1910..2012
1001..1024, 1081..1256, 1497..1589, 1910..2012
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved