Gasterosteus_aculeatus Locus ENSGACG00000008496
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus ENSGACG00000008496
Gasterosteus_aculeatus
ENSGACG00000008496
groupXVII
SNORA63, SNORA63
1763..1892, 2131..2260
4347
GACAGTAGACAGTGTAACAATAGACAACAAGACAGCAGTGCATGATAACATGAAATGCT
AAGTGCAAAATAACATGAAATGCTAATGCAATGGGTTAGTAATTTAAAGTATTTAAAAAG
TTTAGAAATATTAAACAAAGTGCACTATCGAACAAGTGATAAAGTGACGAGTGACGACAA
AGTGACGAGTGAGAAATGACAGTTAAAGTGACATGTGCAGTAAGACGGAGAGTGACCGGT
GGAATGTCAGAGTCAGTCAGTGAGGGACCGGCTCTGTTGATGAGCCCGACTGCCGACGGG
AAGAAACTGTTCGTGTGGTGGGAGGTCTTAGTCCTGATGGACCTCAGCCTCCGGCCAGAT
GGAAGGGGCACAAACAGGTTTTGTCCGGGGTGAGAGGGGTCGGCTACGATCTTTTTAGCT
CGCTTCAATCAACCTGATCCCCAGAGCAGGTCTTTGGACTTTCTTCCCAATTTACCAGAC
CTCCATTCCTTTCATCCCTTGTCTTTGCACTTCTCCCAGCCTGTCCTTCCTTTCCGAGCT
GTACAGTTGTTGTACAGTTTCTGGTGTCTGGCAGTGTTCACAAAGGCCGGGTGGATGCTT
CCATTGTGCAATGCTGCATTCCTATTTCTAGTCTTGACATTGTAATTTATTCTCCCCTGT
TTCCTCCCCTGAATTTTACACTGTTCACTTTAGAATTAGAATTAGAATTGAATTTAAGTG
CCCCCCCCCCCACCTCGTCTCTTGGTCCCATTGTTGTTGCCATACACAGTTGATATTTTT
CCTGACGATGCCCTTTTTCCTCTGCTTTAGATAGCTTTATTTATATTTTTACTTTTATTT
AATTGTAGTGGATTTGATCTTATCGGTGATAGTGTGGCAACAGAAGTGATCGACACAGCA
AGCATCCAATAGCTGGGAAGCTGACGCCCAAAGCTCCTCGTTGATTGGACAGTAGATTCA
TATAAACTCTGCTCGCGTCTTTCCGCTTCCTCTTTCTTTCACGCGACCCTCTTGTGTGAA
GTAAGGACTTGGTTTCGCGCTTTCACAAAATACCTAACATGCAGTGGAATTATCCTATAT
TGTGTATATATGGATTGTTAAAATCGACACGTATCCAATCTAACACTCAAGGTTCAGCAT
GGTCTAACGTAAACACTACTGTGCTAATACTAAGCTACTGTGCTAATACTAAGCTAACGC
TAATGTGCCGCGGCCTGTGATTGCTAGCTGGCTAACGCCACACGCTAGCTGTCGACCTCG
TGGCGGAAAGTATAAACGTTAAACATATTTGTTCCGTTTCTAATGTACATTTAGTAACTA
CTTTATTCTGTGTGTTCAGGTACTACCTTGTCTTTAAACCAGCTTTAAAGCGATCCTTGG
AAGCACTGCAAAGATGCCCAGGGAAGACAGGGCCTCGTGGAAGTCCAACTATTTTATAAA
AATAATCGTAAGTAGGCCCTGACTCGTGACATTTTATTGAAACTCTAGCAAACCTAATGT
ATATACTCTACCGTTTAATCTTAACATTGTGTTCCCCTCTTATTTGTAGCAACTTTTGGA
TGACTATCCAAAATGCTTCATTGTGGGCGCAGACAACGTGGGCTCCAAGCAGATGCAGAC
CATCCGCCTGTCTCTGCGTGGGAAGGCTGTGGTGCTGATGGGTAAAAACACCATGATGCG
CAAAGCCATTCGCGGCCACCTGGAGAACAATGCTGCCCTGGAGAAGTGAGTCTTTTACTT
TAGCTATTTGACATGTTTTTGTCAAGCAGGATAAGTTACAATGCAGTTAGTGGAGTACTG
CTTTGTCGTTCCCCCTGCACACAATAACCTGTTTCCACGCTATACCTGTCAGTCAGCATC
CCTAGACTGCCAGGCACGTACGGTTTCAGACAATTTACACGATATGTATTTGTAGATATG
ATTATCTGCACACCTATTGTAACCGTCAATTCCATGATTTGATAGGCTTCTGCCTCACAT
TAAAGGAAACGTGGGCTTTGTCTTCACAAAGGAGGATCTGGCTGAGGTCCGGGACATGCT
GTTGAACAACAAGGTAATGAAAGTGAAAGAATCTCCAAATACCGCTCCTGATCAACCATG
ATGTTTGAGTAAAAGATCCCACATTTTTATAAAGCAGGATAAGTTACAATGCAGCTTGTG
AAGTACTGCTTTGTCGTTCCCCCTGCAAACAATAACCTGTTTCCACGCTATACCTGTCAG
TCAGCATCCCTAGACTGCCAGGCACGTACGGTTTCAGACACCAATTAACGCATTACGTTA
GTCTCAGGCAACCAGGCAGCAATTTTTAAAATATACTTATTTATATTCAGGAGTCGCGTG
CATAATTGTCCCCCTCTAACAACCCAGGTACCTGCAGCTGCCCGTGCTGGAGCAATCGCC
CCATGTCATGTGACTGTGCCAGCCCAGAACACCGGTCTGGGTCCAGAGAAGACCTCTTTC
TTCCAGGCTCTGGGTATCACCACAAAGATCTCTAAGGGAACCATTGAAATCTTGGTGAGT
TTCTAACTGTTTACTTGAAATGCTGAAAGGATGACTAAGAGAAGCTAATGCTGTCACCGA
AATACTTCAGTATCAGTAATTAAAAAGTCTCTATCCCCAGAGTGATGTCGGTCTGATCAA
GACTGGCGACAAGGTTGGTGCCAGCGAGGCCACGCTCCTCAACATGCTGAACATCTCGCC
GTTCTCCTACGGACTCAACATCCAGCAGGTGTATGACAATGGCAGTGTTTACAGTCCTGA
GGTGCTCGACATCACAGAGGCTTCTCTGCATGCAAAGTTCCTGGAGGTGAGATTCTGCCA
TTGGTAGTTTAATGACAGTTTGCTCAATGCCCAATATTGATTGCTACCAGTGCATGGAAA
TTAACCATTGTTTATTTTTAGGGTGTGAGGAACATCGCTAGCGTTTGTCTGGAGATTGGC
TACCCCACTCTGGCATCTGTCCCTCACTCCGTCATCAATGGCTACAAGAGAGTTCTGGCT
GTTGCTGTTGAGACGGATTACTCCTTCCCCCTGGCAGACAAGGTATGCTTGTTAAATCAT
TAGTTGGCATAAATGTTACACTTTAGTTATACCTGTGTCTTGCATGTTTAGGAAGCAGTT
TAAATGGAAAACTTTAATATATCTTGTTTCCTTTATAGGTCAAGGCCTTCCTGGCAGACC
CGTCCGCTTTTGCTGCTGTCGCAGCCCCTGTAGCAGCTGCAGCAGCGGTGACTTCTGCAG
CTCCAGCTGCTAAGGAAGCGGTTAAGGAGGAGTCTGAGGAATCAGATGACGATATGGGCT
TTGGTCTCTTCGACTAACACAGCGAAGAAACCAGATCTGAGTCAAACATGATTAAATAAA
ATCTGTTAAATCTAAATTGTTGTTTAGAATGAAGTTATTTTAAAACATAAATTTTGGCGG
TCAAAGATTACAGGTTTGTTTGAGTCCTGAATTCTATTCTGATAAAAGTACTACCTGGAA
TTTAAATATTAATGACAAATTGTGTCATAGAGTGGATACCACAATCTGGAACAAGGTTCT
AGAGTTGTTACACTACGTAACACTGCTACGACAATAAGTTAATTGTTACAATGTATACCT
ATTGCGTTAACTGACATGTAACTTTTAAAAAGCCGGTTTTGGTAAACATTCCTTGTATTC
CAACTGATCGATTTCACCAAAGCCTTCAGTTCATGGGGAAAAAGCTTGCCAGTTTATCCT
GGCTCTGTTGCTATCGACATTAGCCCATACCAGTACTACAGTGCACTATTCTAGATTAGC
AAGGAGAAAAAGTACAGCCTACTGACTGGATCACATGATGGGACCTAAATACAAAGAATT
TAGTCTTAATCTAGACAAAGCACAAGTGTAAACTGCTAATTGTTCATCTTACCAATGGCA
ACTTCTGACCAATTTATCACAATGCAATATAACTGTTAAAGGAATTCAAACTATCAGGGT
GACATGAATAATCAGTTTCAGGGTCGTCGTGGCAGAGCGGATGCGCTGGGAACTGCAAGG
TTGGTGGTTAGAGTCCCGGCTGCCCCAAGTCATTCTCCCTGAGCAAGATGCCTAACCCTA
ATTGCTCCCCGGACAAAATGTATAAAGCCATGGGTCGCTTTGGATAAGAGTCAGCTAAAT
GACCTGTAAAGTTTAGAACTATCCTGGAGAACCATCAGTTTTAGGGTGGAGAGGTTTGTT
GCTATGGACCGGAGGGCTGTTCTTTAGAATAGTTTGCAGCTCAACGTTTTTTTCAAACAC
TGGAGGAATTTGGCCTAATTTAAATATGGTTCACTTAAATTCCAAAACTACTGTAAAATA
TGACAAAGTATTATATCCATGTTGCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1022, 1342..1446, 1549..1724, 1965..2052, 2367..2513, 2620..2805, 2901..3041, 3158..3347
1393..1446, 1549..1724, 1965..2052, 2367..2513, 2620..2805, 2901..3041, 3158..3313
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved