Gasterosteus_aculeatus Locus RPL7
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPL7
Gasterosteus_aculeatus
RPL7
groupXXI
SNORD12, SNORD12
2651..2742, 3455..3544
5233
CTTTTAGCGCACCAAATTGTATATGCCTCACATGCTTTATTTGCTAAATGTGTTCTTTT
TATTAGAATTAATTTTCTTGGCATCACACAGACAGAATTTTGGAAAGGCTTAAATAGATT
AGATTTTTTCTCCAGTGAGATCCTCCAGAGGATCACGCGTAAAGGTTCAGGGAAGGGAAT
ATATCCCCCCGGGACCACGAATGTAGAAAGCGCATGGAAGCAGCGTGACCCTGGGCGGCA
GAATGAAGCGTTAGCTCCCTCTGCCGGCTCATCGAGTGCACAGCACTACCATCACCTCCG
GGCTCACGGAAGTATGAAAAGTACCAAACATCAAACCCAGTGGACCGACGTTTCCTTCAT
GTTTGAAAGATTTTTTTTCTTTTATGTGGTTATTTTTTTAGATGGACAATTAAGGATAAT
TTACTAAATAACCCGTACGCAATTTTAGATTTTAAAACAAATTTGGTGTGTATACATTTG
GATTCCATGAAAGATTCAACTCATGTTGGAGCATCATGAAGTTGATGCTATAATTTAACT
TAACAGTCTTCAGAATGTAGAGCCTCAATGTCCTTGGTCATACCTCTCTGCCTGTCCCCA
TTGGCCTTGTATTGATGTTGTACTTTGAGTGTATTTGTGTGTCCGAGCTTAAGCGAATTG
TATGTTTATGTATTTGCCTTTAATCAATACACGCATTGTACCAGAAAAATGGTATCAATG
ACAGAATGAATATTCTAAAGTTAGCTCTGTATTAGCATTCTAGTCTGTTGGAAGTTTTAC
TATGACGCAGTACATTTCGGTGCCATTCAGCCAACGACATTTTAAGAAGTTAATGCCGCA
TTTGATTTCTTAAATAGAATAACATTCACGTTGGTTTGAGAATACTTTTTAAAGTTTTGC
CTGCTACGTTAATGTACAGATCAGGCATCTGGAAGGACAGCCTGTTGAGGTCTTGGGTCC
TAAATCCTTTAACCCGGACATGCGCACATGGGAATCCCTCTTTCTCGGTGGACGCAATGG
CGGACGCAGAGTGAGTGTCTGTGACCTGAGAAAATCTAAGCACATCGGCGGTTAAAATAG
TCATCGTTGTGCATTTTACATGCTGTATAGATTGTTTAGATTGCGTACACCGTCGCACTA
GTTGTATTGTTTAGGATTATCGTTATTTTAGTTGTTTGTCACTTTATGGTTTCTTGTGTG
TAGTCCTTAGCGGTACAACATGGCTCTCTCTACCGCCTCCGTACTCGATAAGAAGCTAGC
TAATCGTGCTAATAGGAGAACTAACTTGGGAATCAGCTGCCATAGTTCCTTTCGTGCTGC
TGTTAATGGTTTCAAGACACGTCTTTAGGTCTTCGGTGAAGTGAGAACACTTGAGTATGG
GAGCCGGTAAATGGGAGGTTAGCTAATTTAGCTTCTTAGCATACCAACAAATGCGGTTTT
TAAAAAATGCATCTCAATGGCTTTTTCCTACGAGAATATCCGTAGTTTTCTGTGTCTCTC
GACTTGTTTTGTAATGTTCTGGTTTGTCCACGACAGAAAAAAAGTGCCGGTGGTCCCGGA
GAGCCTTTTGAAAAGGCGAAAGGCCTTTGCCGCCATGAAGGCCGCGCGCGTCAAGAAGCT
GCTGGCCGACAAAAAGGTGTGTAAGCACGCGTGTTTTCGTTCTGCTCAATTTTTTTTTTA
CTCCTGTAATGTGTCGGGTGAACATGTCCGTGGGCTTATCAATGTTATTCCTGCTTGCTA
AGGCCCGCAAAGTGACCAGGAAACTGATCTACAAGAGGGCTGAGATGTACCATAAGGAGT
ACAGGCAGATGTACAGGCGTGAAGTTCGCCTGGGCCGCACTGCTCGCAAAGTGGGAAATT
TCTACGTGCCGGCCGAGCCCAAACTGGCCTTTGTTGTCCGGATCCGAGGGTGAGTTCAGC
CAGTGTCTTAAGCACAGAAATGTAACGCGTGGCAGACCGAAACCAAACAGTGAGATTTAC
ATGGATTGCTACATTTCTTATTAGAACCGCATACCATCGTGTCTCAGTTAGAGCAGCAGT
TTAGATCTCTGCTCACGTGCTGGGTTGCTAATTTGAAATGCCATTTACATGGTTATTTGC
CTTAAATAAACCCTGTCTAGCTATGTCTTGCATGCTCGTACTACCTGAGTTACTCAAAGC
ACGAGTCAAGGTTTCCTTCAATAATGCCTACGTTTGGTTCCTATTGCAATCCATGTAAAT
GTCTCATGGTACTGTCTGCAGATGCCTAGTTGGTCGTGTGGTTAATGATGAACAATTCTT
TCCCCGACTTATCGACTATGATGATACATCCTTGCAAAATAAGCCAAATATTCTGAGACC
ACAATGAACAGAGTTGATGAGAAAGTTGTACACCAATGCCATGTGCTAATCTGTTCCATC
TATTCTTTCAGTATCAATGGTGTCAGCCCCAAGGTCCGCAAAGTTCTGCAGCTGCTTCGT
CTCCGCCAGATCTTCAACGGTGTGTTTGTCCGACTGAACAAGGCTTCAATCAACATGCTC
AGGATTGCTGAGCCTTACATCGCTTGGGGGTAATTGAGGCTACAAAACTTAGACGTCGAC
CTCATATTGCAGACGCAATTCATTGTGTGCTGAAATGAACAATTATTAGTGACCAGGTGC
TTTATCTCTGGAATGTGGTTGATGATGCTGAACTTTTTTCCCCATCTTATCGACCATGGT
GAATACTGACTTAAACTAAGCCAGTTTAGTCTGAAACCACATTCCATGGTACAGAACAAT
TTTCAGTATAAACGCTTTAAACAAAAGTTCCCAGGTTTGATAAGAGTTAATTTCATAACC
ATGTATTATCTGTTCCACCAGATACCCCAACCTGAAGTCTGTGCGTGAGCTCATCTACAA
ACGTGGCCACGGCAGGCTGAGGAAACGGCGCGTTGCCCTCACCGACAACGCTCTGGTGGA
GTCGGCCCTCGGTATGTAAACTTAATGCCTTGGACGTCTCTCCATTTGGTCTAGTGTGTC
GGATGCAGTTTCTTACGGAACCCCGAAGGAAAGTCTTCATAATTTGTACAAATGTCCACC
GTGACTTTTGATGTATTTATTTTTGGAGGTCTTGTGCCTTCAGTTTTTGGCCCATAACTG
AAGAGATTTACCAATCGTATCAATTTCAAATATACATTTCCTAATAGGATGAAATTAGGG
AGGACATTGTGAAAAGACATGGATGTGAACTGCAACATGACTGTTTGGCGAAGAATTTCA
ACCAGATGTGGTAATTGTAGTTTGTTTTGAGACAAAAGACGTGTATGTACATAACACAGT
ATACATGTGCTTCTATGAGGGCCGATTGTACTAACGAATCAACATACTTCCCCAATGAGA
ATCATTTCTTTAGGAAAATGGTTATGGCAGTTACAGTATTTAGTGTTAATAATTTCTTCT
AAAAAGCTATTTAACAAGTTATATCAGTAGTGCTACATGTGGTTAATGATGTACACTTTT
TTCCCCGTCTTATCGACCATGGTGAGAAAGCTTAAAACTAAGCCAGTTGTATCTGAAACC
ACAAACCGAAACAGTGACCTGAACACTGGGATGGATTAGACGCTGCACTCATCAGATTGC
ATTATAACTCCTGACATGTTCGAATAAAAGGATATATCACATAATTCAGAAATGCTTTCA
GTGTGCTGGAAGCTGCGCGGTTCAGTTTATTAAACTCACTGCTTTTTGATCCCCAGGCAA
ATATGGCATCATCTGTGTTGAAGACCTCATTCACGAGATTTACACAGTTGGAAAGAACTT
CAAGTCTGCCAACAACTTCCTGTGGCCCTTCAAGCTGTCGTCACCCCGCGGTGGCATGAA
CAAGAAGACCACACACTTTGTGGAAGGAGGAGACGCTGGCAACAGGGAGGATCAGATCAA
CAGAATGATCAGGAGGATGAACTAAAGTGATGGTGAGTTGTAGCGAGGGTCCTAGAAAGA
TAAAAATGGCTTGGCTGTGGTTGATGATGCAAAATCTTTTTTCCCCATCTTATCGACTAT
GGTGAAAACCATCTGAAATTAAGCCAAATATGACTGAAACCACATCTAAGCCGTTAAATA
TAAGACAATGATTTGTGTGCTGGTTGATGTTATTTAGTGACCATTGTTCTGGTAATTCCT
CCAGAACACCATATTTAGTTTCTCCAATTAAACTTTTTTTTGGTCTTTTTCAGGTGTTCA
AAGGACTCAAAATGTACAATAAAATCTTGGCGGAAAACTTGTCTTCTCATCATTGATGTG
ATTGTGCTATTTTGATTTAGTATGTGTCAATTATGGTAATGGAGAGAGGGGTCAGACAGC
ACTTTTGTAGCTCAATCCAATTTAAGGTTTTAAGTCGAGTTTCCAATAAATAAACCACAT
TGACCGCTGAAAAGATAAGCGGAGAACAATATAAACAAATCTGCATTGCACATATAACAA
AGTGTGGGCGTATTTGAATAATTCTATATTAGTACATTAAAGGCGGTAAAAACACTCATC
TTATGCATGGGTCAGAGCAACGGTTTCGTGGAGCCCGTTTCCATGGTGACGTTGAGACTG
ATGCACCGACCGCGGGCAGCAGCGTAGCGTTGCCTCTCGGGGAGGACGTCTCATCTGTTA
CGATCACTCATAAGAACCACGGGCCTCACATTCCACCCGTAACCTTTCATGGCGCAAACA
TGTACATCAACTCCGGCACGACGACGCTCCGGGTCGACGCGCCGCTGCCCGCATCGGAGG
AGCGCCCGAGCGACACCCGGCGCGGCCCTGGCGCTTGTGGCGTTGGGTGGCTGGCACACG
GGCACCTCGGTGTGGGAGCAGGTGGACAACCGGCTCTCGGACAAAATAATCACATGCGGA
GGAAATTGCCCGCGATACAACCGCCGAGCAGTAAGTAAGAGCGCTGCGTGTCGCCGCCGG
ACTCCTTCACATTGCGCCGTGTGGGCGGTGGGATTAATGCGCATCACCGTTCGTCTGTGT
TGCGGAGCGCCGGGATTGGGAAAGCTTGTTTAGAGGCTTTATGGTTGCAGGGTAAGATGT
GTTGAGGGGTTTGACTCCCTCTTGTTTCCTGGTGCTGAGCGTGTCCTGTGCTCGTTATGG
CTTTTACCTCGCAATCTATTCAACCGGATATATAAGCGAGCAGTTCCACATGAAGGCACA
ATACGTTTTGCTCTTTTTGTGGATAAATGCAGAGTTATTCAGGGTTGATATTCACAGCTG
CAGTCCATGCGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1536..1635, 1742..1908, 2411..2548, 2841..2950, 3716..3931, 4193..4233
1016..1029, 1536..1635, 1742..1908, 2411..2548, 2841..2950, 3716..3921
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved